• Home

Research

Due: April 30th, 2022.


Assignment:

required to research and compare and contrast the incidence of human trafficking in any two countries around the world. You are also at liberty to select more than two countries for your analyses and comparison. In your essay, provide a detailed but relevant information about your selected countries. Such relevant information may include, but not limited to location, population size, economic conditions, and cultural practices that aid or prevent contemporary slavery and human trafficking. You will need to discuss the countries’ strategies and policies to combat human trafficking in persons, any challenges they may have encountered, and how impactful such strategies have been. As a scholar of trafficking in persons, you are expected to critique or identify the weaknesses in their strategies and to recommend ways to ensure effective approaches to trafficking in persons.


5pages


4 Sources

research

ENC 1102, 3/28/22

Prof. Scarpati

Second Research Paper, due Wednesday, April 27, 2022

St. Thomas University, Miami Gardens, FL

Research Paper

Your second research paper, 7 – 10 pages in length with a bibliography and citations (follow the MLA for pagination purposes), will be due Wednesday, April 27, 2022, a week prior to our last class and final exam date of Wednesday, May 4, 2022. This paper must be on another topic and different literature than the focus of your first research paper. Your analysis of the literature studied in class either from the time leading up to the mid-term exam or afterward must reach at least seven pages, as the bibliography—titled References—should not be considered when page length is provided. Follow the examples in the MLA style sheet that are presented in the text or access the Modern Language Association’s style sheet on the net or in the stacks in the library, to paginate your secondary sources that bolster and support your thesis statement. I suggest emailing me your thesis statement before beginning.

Process

This is just a suggestion as writing is an individual thing, but we will cover the process of analyzing literature in class several times by first writing an outline, in order to find major topics for development, to include material to be covered in different paragraphs, and to arrive at a thesis statement. The best way to approach this outline is first to determine the literature that you would like to consider for development. Don’t spend too much time with regard to this assessment; just go with your feelings following a first or second read of the short story of your choice. You may want to include more than one story for development of your thesis statement, but you certainly don’t have to do this. The way that I approach the outline is to randomly write my assessments of what I believe to be major areas for development by the author. You can include specific parts of the story for inclusion in these major areas, or you may want to include these areas in a separate process where notes on the primary story take place. Either way the idea is to present a major idea for development in a topic sentence with specific details concerning information presented by the author in the story included to round out the examples you present in your paragraphs. That is the essence of good writing, broad general ideas presented in your topic sentences with four to six sentences provided as examples supporting these topic sentences in the rest of the paragraph. Focus on the thesis statement should be your number one concern. Consider utilizing transitions leading your reader from one sentence to the following one and from one paragraph to the next.

References

It is not imperative to research many secondary sources to bolster your thesis. But it is wise to take notes based on your secondary research of outside sources and how these writers analyze the story under consideration and how these assessments apply to your thesis statement. Instead of quoting directly from these sources, it is suggested you provide your assessments of these writers’ analysis, by incorporating a synthesis of assessing why their words make sense to support your thesis. Using wording such as “According to” when introducing outside secondary sources and then naming the author’s last name and then proceeding with your take on why the information makes sense in the course of your development of the thesis is highly suggested. When you use direct quotes, the effect is jarring because the professional writer will certainly have a greater grasp of the language than you do. Also, using many direct quotes leads me to believe that you are desperate to reach the minimum length. Just believe in your own assessments and analysis of the literature, and you will most likely be in better shape than to place too much emphasis on published assessments of the literature.

Proofing

Give yourself a couple of days before finalizing the editing of your work. The best scenario is to finish the paper and then return to it in a day or two, to begin the proofreading process. Pay attention to grammar and the notion of providing variety with respect to sentence structure throughout your essay. Subject-verb agreement should also be strongly considered, as should run-on constructions (avoid) and fragments (also avoid).

Good Luck

It is highly suggested to send me your thesis statement before beginning your research and writing. A quick email to my stu email address would suffice, and this way I can assess if your statement is argumentative and says something of substance before you begin. I can make suggestions to improve your thesis, if applicable.

research

Clinical and Experimental Surgery

S. Karger

Medical and Scientifi c Publishers

Basel . Freiburg . Paris .

London . New York .

New Delhi . Bangkok . Beijing .

Tokyo . Kuala Lumpur .

Singapore . Sydney

Eur Surg Res

49(2) 53–106 (2012) 49 | 2 | 12
print

ISSN 0014–312X

online

e-ISSN 1421–9921

www.karger.com/esr

G
en

er
al

M
ed

ic
in

e;
In

te
rn

al
M

ed
ic

in
e;

C
ar

d
io

va
sc

u
la

r
Sy

st
em

,
G

er
ia

tr
ic

s,
Im

m
u

n
o

lo
g

y,
In

fe
ct

io
u

s
D

is
ea

se
s,

N
eu

ro
lo

g
y,

M

et
ab

o
lis

m
, N

ep
h

ro
lo

g
y,

O
n

co
lo

g
y,

P
h

ar
m

ac
o

lo
g

y,
P

sy
ch

o
lo

g
y,

P

sy
ch

ia
tr

y,
S

o
ci

al
M

ed
ic

in
e,

U
ro

lo
g

y

P l e a s e s e e t h e f u l l c o n t e n t s o n :
www.karger.com/gender_medicine

Handbook of Clinical Gender Medicine
Editors: Schenck-Gustafsson, K. (Stockholm);
DeCola, P.R.; Pfaff , D.W. (New York, N.Y.); Pisetsky, D.S.
(Durham, N.C.)
XVI + 522 p., 62 fi g., 4 in color, 63 tab., soft cover, 2012
CHF 69.– / EUR 51.– / USD 69.00
Prices subject to change
EUR price for Germany, USD price for USA only
ISBN 978–3–8055–9929–0
e-ISBN 978–3–8055–9930–6

GGTATCCAATGATAAGCATGATAAAAGCTCACGGTATCCAATGATAAGCATCACGGTATCATCCAATGATAAGCATGAT
TATCCAATGATAAGCATCACGGTATATCCAATGATAAGCATGATAAGCTCACGGTATCCAAAATGATAAGCATCACGG
AGCATGATAAGCTCACGGTATCCAATATGATAAGCATCACGGTATCCAATGATAAGCATGATATAAGCTCACGGTATC
AGCATCACGGTATCCAATGATAAGCATTGATAAGCGTG ATCCAATGATAAGCATCACGGTATCCCCAATGATAAGCAT
GGTATCCAATGATAAGCATCACGGTATCCCAATGATAAGCATGATAAGCCACGGTATCCAATGAGATAAGCATCACG
GATAAGCATGATAAGCTCACGGTATCCAATGTGATAAGCATCACGGTATCCAATGATAAGCATGATATAAGCTCACGG
AGCATCACGGTATCCAATGATAAGCATGATAAAGCTCACGGTATCCAATGATAAGCATCACGGTATCTCCAATGATA
AGCTCACGGTATCCAATGATAAGCATCACGGTATATCCAATGATAAGCATGATAAGCTCACGGTATCCAAATGATAA
TATCCAATGATAAGCATGATAAGCTCACGGTATCCACAATGATAAGCATCACGGTATCCAATGATAAGCATATGATAA
CAATGATAAGCATCACGGTATCCAATGATAAGCATGGATAAGCTCAA CGGTATCCAATGATAAGCATCACGGGGTATC
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACACGGTATCCAATGATAAGCATGATAAGCTCACGGTATATC
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGGTATCCAATGATAAGCATCACGGTATCCAATGAATATA
AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAGATAAGCATGATAAGCTCACGGTATCAGCATGATA
TATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATATAAGCTCACGGTATCCAATGATAAGCATCACGG
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCTCCAATGATAAGCATGATAAGCTCACGGTATC
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCCAATGATAAGA CATCACGGTATCCAATGATA
AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCACATGATAAGTCACGGTATCCAATGATAAG
TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACACGGTATCCAATGATAAGCATGATAA
CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATATCCAATGATAAGCATCACGGTATC
AGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAATAAGCATGATAAGCTCACGGTATCC
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAAAGCATCACGGTATCCAATGATA
AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGAGCTCACGGTATCCAATGATAA
TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCTCCAATGATAAGCATGATAA
CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGTGATAAGCATCACGGTATC
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGAGATAAGCTCACGGTATC
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACACGGTATCCAATGATA
AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGGTATCCAATGATAA
TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATATAAGCATGATA AA
CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATATCACGGTATC
AGCATGATAAGCGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTGTATCCAATG
GGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCGCATGATA
TATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATATCACGG
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGGTATC
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAGATA
AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATTAAA
TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAA
CAATGATAAGCATCACGGTATCCAATGATAAG
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATC
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATA
AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAA
TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAA
CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATC
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGTCACGGTATCC
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATA
AGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAG
TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAA
CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATC
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATC

TGATA
ATCCA

GATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATG
GGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGAT
TATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGG
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCAC
AGCATCACGGTATCCAATGATAAGCATGATAAGCGTAT
GGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATCACG
GATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGG
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGAGTATCCAATGAT
AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAA
TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAA
CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATC
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATC
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATA

TAATCCCAAATGATTAACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCGGTATCCAATGAATAAGCATGATAAA CTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATCCAAATGA AAGCCATCACGGTAT CAATGATAAGCAAT

GCATTGATAAGATAAGGTATCGGTATCTATCCCAATGCATCACGGTATCCGCATCACGGTATCCCACGGTATCCAATGCAACGGTATCCCAATGACGGACGGTACGGTACGGTACGGACGGTACGGTCGCGCGACGGACCA TGAGAGAGATGATGATTGATGATGATGATATAAAAAAAAGAGAAAAAAAAAAAA

AGCCATTCACGGGTAATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCCAATGATAAGCATCACGGTATCCAAAGCATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTAAGCATAAGGCATCACGGGTATCCAATGATAAGCATGATAAGCTCAACGGTATCCAATGATAAGCATCACGGTAAAAAAACCCCCGGCCGGGGGGG CCACAAAAAAAAAAATATA
AGCATAG CACGGGTATCCAATGATAAGCATGATAAG
AATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAT
TGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAATGATAAGCATCACGGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAA

TAAAGCAATGATACAATGATTAATGATAAGCTGATAAGCCATTGATAAAGATCCAATGATAAGATTCCAATGATATAAGGCATGATAAGCTCGCCATGATAAGGCTCACGGAAGCATGATAGCATGATATCACGGTATCACGGTGTGTTGTTTATCCAATCCAATCCAATCCATCCAATCCAATCCATCCATCCACCATCCATCCAATCCACCACCAAA AAAAAAAAAACGGACGACGGACGACGGACGGACGACGGACGGACGGGGACGGACGACGACGA GCAGCACGCACAGCACACACACACAGCAGCATGTGTGTGATGATGATTGATGTGATGAGTGAGTG

Handbook of
Clinical Gender
Medicine
Editors

Karin Schenck-Gustafsson
Paula R. DeCola
Donald W. Pfaff
David S. Pisetsky

K
I 1

2
4

3
5

A new vision to understanding medicine

Handbook of
Clinical Gender
Medicine
Editors

Karin Schenck-Gustafsson
Paula R. DeCola
Donald W. Pfaff
David S. Pisetsky

Gender medicine is an important new fi eld in
health and disease. It is derived from top-quality
research and encompasses the biological and so-
cial determinants that underlie the susceptibility
to disease and its consequences. In the future, con-
sideration of the role of gender will undoubtedly
become an integral feature of all research and
clinical care.
Defi ning the role of gender in medicine requires a
broad perspective on biology and diverse skills in
biomedical and social sciences. When these scien-
tifi c disciplines come together, a revolution in
medical care is in the making. Covering twelve dif-
ferent areas of medicine, the practical and useful
‘Handbook of Clinical Gender Medicine’ provides
up-to-date information on the role of gender in the
clinical presentation, diagnosis, and management
of a wide range of common diseases.
The contributing authors of this handbook are all
experts who, in well-referenced chapters, cogently
and concisely explain how incorporation of gender
issues into research can aff ect the medical under-
standing and treatment of heart disease, osteopo-
rosis, arthritis, pain, violence, and malaria among
other conditions. This intriguing and unique med-
ical textbook provides readers with a valuable new
perspective to understand biology and incorpo-
rate gender issues into the diff erent branches of
medicine.

Contents

Foreword: Wainer, J.; Wainer, Z.
Preface: Schenck-Gustafsson, K.

Introduction
Gender Matters: Wainer, J.; Wainer, Z.
Biological Sex and the Genome: What Makes

Us Ourselves? Legato, M.J.

Social and Biological Determinants in
Health and Disease
Section Editors: DeCola, P.R.; Schober, J.M.

Central Nervous System and
Clinical Applications
Section Editor: Pfaff , D.W.

Neurology
Section Editor: Olsson, T.

Pain
Section Editor: Murphy, A.Z.

Circulation
Section Editor: Schenck-Gustafsson, K.

Cancer
Section Editor: Gustafsson, J.-Å.

Metabolic Disease
Section Editor: Werner, S.

Autoimmune, Infl ammatory, and
Musculoskeletal Disease
Section Editor: Pisetsky, D.S.

Infectious Diseases
Section Editor: Britton, S.

Urology, Sexual Dysfunction,
and Nephrology
Section Editor: Arver, S.

Pharmaceutical Drugs
Section Editor: Parekh, A.

Geriatrics
Section Editor: Herlitz, A.

Please send: copy/ies

Postage and handling free with prepayment

Payment:
Please charge to my credit card
� American Express � Diners
� MasterCard � Visa

Card No.:

Exp. date:

CVV/CVC
(3 digits in the signature fi eld on the back of Visa and MasterCard)

� Check enclosed � Please bill me

Orders may be placed with any bookshop, subscription
agency, directly with the publisher or through a Karger
distributor.

Fax: +41 61 306 12 34

S. Karger AG, P.O. Box, CH–4009 Basel (Switzerland)
E-Mail orders@karger.ch, www.karger.com

Name/Address:

Date:

Signature:

O
r

d
e

r

F
o

r
m

Printed in Switzerland
on acid-free and non-aging
paper (ISO 9706) by
Reinhardt Druck, Basel

Appears 6-weekly:
2 volumes per year
(8 issues)

Editor-in-Chief

B. Vollmar, Rostock

Accociate Editors

M. Boros, Szeged
M. Büchler, Heidelberg
W.P. Ceelen, Ghent
M.D. Menger, Homburg/Saar
H. Thorlacius, Malmö/Lund

Editorial Board

I. Alwayn, Halifax
D.K. Bartsch, Marburg
C. Bassi, Verona
W.O. Bechstein, Frankfurt am Main
J.A. Bradley, Cambridge
M. Cikirikcioglu, Geneva
P.-A. Clavien, Zurich
C. Eipel, Rostock
R.W.F. de Bruin, Rotterdam
H. Friess, Munich

S. Fichtner-Feigl, Regensburg
G. Galata, London
D.J. Gouma, Amsterdam
J.K. Habermann, Lübeck
M. Heberer, Basel
W.R. Jarnagin, New York, NY
J.C. Kalff, Bonn
M.W. Laschke, Homburg/Saar
H.-A. Lehr, Lausanne
C.M. Malata, Cambridge
T. Minor, Bonn
M. Morino, Torino
J. Pirenne, Leuven
R. Schramm, Munich
L. Steinstraesser, Bochum
T.M. van Gulik, Amsterdam
M.A. Venermo, Helsinki
D.C. Winter, Dublin
Y. Yamamoto, Akita

Clinical and Experimental Surgery

Founded 1969
Editors: W. Brendel (1975–1989†) and K. Messmer (1975–2005); O. Kempski
(2005–2011)

GzD 2012

EB
GL
GI

Fax +41 61 306 12 34
E-Mail karger@karger.ch
www.karger.com

© 2012 S. Karger AG, Basel

The Guidelines for Authors are available at:
www.karger.com/esr_Guidelines

Guidelines for Authors

Aims and Scope
The prime mission of European Surgical Research is to
publish high-quality original manuscripts of basic and
translational research and review articles concerned with
laboratory and clinical investigations which are relevant
to surgical practice and of general interest to a broad
range of academic surgeons and surgical researchers.
Manuscripts dealing with research relevance to human
surgical diseases are given high priority along with those
which explore the pathogenesis, etiology, and mecha-
nisms of disease processes. European Surgical Research
seeks to preferentially publish research articles that in-
tegrate molecular biological methods, along with func-
tional studies, into the analysis of biological questions
and that advance basic and translational knowledge of
surgical pathophysiology. European Surgical Research
will provide an international platform for basic and
translational research and clinical investigations impact-
ing directly on surgical care and management. European
Surgical Research also features special articles relating to
educational, research, or social issues of interest to the
academic surgical community.

Submission
Only original papers written in English are considered
and should be submitted online:

www.karger.com/esr

All manuscripts must be accompanied by a cover letter
and copyright signed by all authors. Assurance should be
given in the cover letter that the manuscript is not un-
der simultaneous consideration by any other publication.

Authors may suggest up to five referees who have expert
knowledge on the subject. Suggested referees should not
be from the same institution, not have published with
the authors during the last 5 years, and should not be
prejudiced.

Manuscripts may be submitted to the following sections:
(1) Original Papers on basic, translational and clinical
science
(2) Technical Notes
(3) Systematic Reviews and Meta-Analyses

Original Papers: These manuscripts should represent
original research in basic, translational, or clinical sci-
ence. Consideration for publication is based on originali-
ty, novelty, scientific soundness, and appropriate analysis.
European Surgical Research encourages the submission of
relevant and well-conducted work in basic, experimental,
and clinical science. Manuscripts should be prepared ac-
cording to the guidelines for original papers.

Technical Notes: These manuscripts present a new meth-
od, experimental model, test procedure, tool, or algo-
rithm that is relevant for surgical research and signifi-
cantly advances current available knowledge.

Systematic Reviews and Meta-Analyses: European Sur-
gical Research aims to publish expert basic and transla-
tional reviews of selected up-to-date topics in experimen-
tal surgery. On occasion, the Editor-in-Chief will invite
additional clinical or basic science reviews on a specific
topic, which are usually presented pair-wise. Exceptions
include formal true Systematic Reviews with Meta-Anal-
yses which are well performed, and which are considered
Original Papers.

Should you experience any problems with your submis-
sion, please contact: esr@karger.ch

Editorial Office ‘European Surgical Research’
S. Karger AG
Angela Lorenz
PO Box
CH–4009 Basel (Switzerland)
Tel. +41 61 306 13 58
Fax +41 61 306 14 34

Conditions
All manuscripts are subject to editorial review. Manu-
scripts are received with the explicit understanding that
they are not under simultaneous consideration by any
other publication. Submission of an article for publica-
tion implies transfer of the copyright from the author to
the publisher upon acceptance. Accepted papers become
the permanent property of European Surgical Research
and may not be reproduced by any means, in whole or in
part, without the written consent of the publisher. It is the
author’s responsibility to obtain permission to reproduce
illustrations, tables, etc. from other publications.

Disclosure Statement
Authors are required to disclose any sponsorship or
funding arrangements relating to their research and all
authors should disclose any possible conflicts of interest.
Disclosure statements will be published at the end of the
text of the article.

Plagiarism Policy
Whether intentional or not, plagiarism is a serious vio-
lation. We define plagiarism as a case in which a paper
reproduces another work with at least 25% similarity and
without citation.
If evidence of plagiarism is found before/after acceptance
or after publication of the paper, the author will be offered
a chance for rebuttal. If the arguments are not found to
be satisfactory, the manuscript will be retracted and the
author sanctioned from publishing papers for a period to
be determined by the responsible Editor.

Ethics
Published research must comply with the guidelines for
human studies and animal welfare regulations. Authors
should state that subjects have given their informed con-
sent and that the study protocol has been approved by the
institute’s committee on human research. Further, they
should also state that animal experiments conform to in-
stitutional standards. Authors are required to declare the
approval codes obtained from the corresponding ethical
committee on human and/or animal research.

Arrangement
The manuscript should conform to the following or-
der: title page, abstract and key words, body, acknowl-
edgments, references, figure legends, tables and figures.
Manuscripts should be written in high-quality English
suitable for effective communication to a professional
medical audience. Authors who are not native speakers
of English sometimes receive negative comments from
referees or editors about the English-language usage in
their manuscripts, and these problems can contribute to
the decision to reject a paper. To help reduce the possi-
bility of such problems, we strongly encourage such au-
thors (i) to have their manuscript reviewed for clarity by
a colleague whose native language is English and/or (ii)
to use one of the many English language editing services
that are available via the Web.
All pages, including the figure legends, should be num-
bered in sequence, and the first author’s name should ap-
pear at the upper right corner of each page. Papers not
conforming to the journal style will be returned with-
out review.

Title page: The first page of each paper should indicate a
concise title of no more than 150 characters, all authors’
names (first name and surname), authors’ institutional
affiliations, and a short title for use as running head.

Corresponding author: The exact postal address of
author(s) to whom correspondence, proofs, and reprint
requests should be sent, including the postal code, must
be given at the bottom of the title page. Please also supply
phone and number and e-mail address.

Abstract: Submit the abstract on a separate page. The ab-
stract is structured into Background/Purpose, Methods,
Results and Conclusions and should be less than 400
words in length.

Key words: Following the abstract, an alphabetical list
of five key words that reflect the content of the paper
should be given.

Footnotes: Avoid footnotes.

Body of manuscript: The text should be organized into: In-
troduction, Materials and Methods, Results, Discussion,
Acknowledgments, including grant numbers and sourc-
es of support, Disclosure/Duality of Interest (optional),
and References. Abbreviations/acronyms are defined in
both the abstract and body of the text as follows: vascular
permeability factor (VPF); transforming growth factor-
b (TGF-b). They should only be used in the abstract if
they appear twice after first being mentioned and in the
body of the text only if they appear three times after first
being mentioned.

Tables and illustrations: Tables and illustrations (both
numbered in sequential Arabic numerals) should be pre-
pared as separate files. Tables require a brief and concise
heading. Figures require a legend, prepared as a separate
page, after references. Please use scale markers for elec-
tron micrographs, and indicate the type of stain used. For
the reproduction of illustrations, only good drawings and
original photographs can be accepted; negatives or pho-
tocopies cannot be used. Due to technical reasons, fig-
ures with a screen background should not be submitted.
When possible, group several illustrations in one block
for reproduction (max. size 180  223 mm) or provide
crop marks. Electronically submitted b/w half-tone and
color illustrations must have a final resolution of 300 dpi
after scaling, line drawings one of 800–1,200 dpi.

Color illustrations
Online edition: Color illustrations are reproduced free of
charge. In the print version, the illustrations are repro-
duced in black and white. Please avoid referring to the
colors in the text and figure legends.
Print edition: Up to 6 color illustrations per page can
be integrated within the text at CHF 800.– per page.

References: In the text identify references by Arabic
numerals [in square brackets]. Material submitted for
publication but not yet accepted should be noted as
‘unpublished data’ and not be included in the refer-
ence list. The list of references should include only
those publications which are cited in the text. Do not
alphabetize; number references in the order in which
they are first mentioned in the text. The surnames of the
authors followed by initials should be given. There
should be no punctuation other than a comma to sepa-
rate the authors. Preferably, please cite all authors. Ab-
breviate journal names according to the Index Medicus
system. Also see International Committee of Medical
Journal Editors: Uniform requirements for manuscripts
submitted to biomedical journals (www.icmje.org).

Guidelines for Authors

Examples
(a) Papers published in periodicals: Chatel J-M, Bernard
H, Orson FM: Isolation and characterization of two com-
plete Ara h 2 isoforms cDNA. Int Arch Allergy Immunol
2003;131:14–18.
(b) Papers published only with DOI numbers:
Theoharides TC, Boucher W, Spear K: Serum inter-
leukin-6 reflects disease severity and osteoporosis
in mastocytosis patients. Int Arch Allergy Immunol
DOI: 10.1159/000063858.
(c) Monographs: Matthews DE, Fare-well VT: Using and
Understanding Medical Statistics, ed 3, revised. Basel,
Karger, 1996.
(d) Edited books: DuBois RN: Cyclooxygenase-2 and
colorectal cancer; in Dannenberg AJ, Dubois RN (eds):
COX-2. Prog Exp Tum Res. Basel, Karger, 2003, vol 37,
pp 124–137.

Reference Management Software: Use of EndNote is
recommended for easy management and formatting
of citations and reference lists.

Digital Object Identifier (DOI)
S. Karger Publishers supports DOIs as unique identifiers
for articles. A DOI number will be printed on the title
page of each article. DOIs can be useful in the future for
identifying and citing articles published online without
volume or issue information. More information can be
found at www.doi.org.

Supplementary Material
Supplementary material is restricted to additional data
that are not necessary for the scientific integrity and con-
clusions of the paper. Please note that all supplementary
files will undergo editorial review and should be submit-

ted together with the original manuscript. The Editors
reserve the right to limit the scope and length of the sup-
plementary material. Supplementary material must meet
production quality standards for Web publication with-
out the need for any modification or editing. In general,
supplementary files should not exceed 10 MB in size. All
figures and tables should have titles and legends and all
files should be supplied separately and named clearly. Ac-
ceptable files and formats are: Word or PDF files, Excel
spreadsheets (only if the data cannot be converted prop-
erly to a PDF file), and video files (.mov, .avi, .mpeg).

Author’s ChoiceTM
Karger’s Author’s ChoiceTM service broadens the reach
of your article and gives all users worldwide free and full
access for reading, downloading and printing at www.
karger.com. The option is available for a one-time fee of
CHF 3000.–, which is a permissible cost in grant alloca-
tion. More information can be found at www.karger.com/
authors_choice.

NIH-Funded Research
The U.S. National Institutes of Health (NIH) mandates
under the NIH Public Access Policy that final, peer-re-
viewed manuscripts appear in its digital database within
12 months of the official publication date. As a service to
authors, Karger submits your manuscript on your behalf
to PubMed Central (PMC) immediately upon publica-
tion. It usually receives a PMCID within approximately
a month and will appear in PMC after 12 months. For
those selecting our premium Author’s ChoiceTM service,
the usual embargo will be overridden, accelerating the
accessibility of your work.

Self-Archiving
Karger permits authors to archive their pre-prints (i.e.
pre-refereeing) or post-prints (i.e. final draft post-refer-
eeing) on their personal or institution’s servers, provid-
ed the following conditions are met: Articles may not be
used for commercial purposes, must be linked to the pub-
lisher’s version, and must acknowledge the publisher’s
copyright. Authors selecting Karger’s Author’s ChoiceTM
feature, however, are also permitted to archive the final,
published version of their article, which includes copy-
editing and design improvements as well as citation links.

Page Charges
A charge of CHF 125.– per page will be levied for the first
4 printed pages of an article. Any additional page will be
charged to the author at CHF 325.–. The allotted size of a
paper is equal to approx. 12 manuscript pages (including
tables, illustrations and references).

Proofs
Unless indicated otherwise, proofs are sent to the cor-
responding author and should be returned with the least
possible delay. Alterations other than the correction of
printer’s errors are charged to the author.

Reprints
Order forms and a price list are sent with the proofs. Or-
ders submitted after the issue is printed are subject to
considerably higher prices.

Frontiers of Gastrointestinal Research

Editor: C. Sakamoto

Vol. 30

Cell/Tissue Injury and
Cytoprotection/Organoprotection
in the Gastrointestinal Tract
Mechanisms, Prevention and Treatment

Editors

L. Filaretova
K. Takeuchi

Frontiers of
Gastrointestinal Research
ISSN 0302–0665
e-ISSN 1662–3754

Listed in bibliographic services,
including Current Contents®,
Reference Update, Biological Abstracts.

Vol. 30: Cell/Tissue Injury and
Cytoprotection/Organoprotec-
tion in the Gastrointestinal
Tract
Mechanisms, Prevention and Treatment
Editors: Filaretova, L.P. (St. Petersburg);
Takeuchi, K. (Kyoto)
VIII + 250 p., 49 fi g., 10 tab., hard
cover, 2012
CHF 182.– / EUR 152.– / USD 214.00
ISBN 978–3–318–02183–7
e-ISBN 978–3–318–02184–4

Vol. 29: Free Radical Biology in
Digestive Diseases
Editors: Naito, Y. (Kyoto);
Suematsu, M. (Tokyo); Yoshikawa, T.
(Kyoto)
VIII + 176 p., 36 fi g., 3 in color, 9 tab.,
hard cover, 2011
CHF 182.– / EUR 152.– / USD 214.00
ISBN 978–3–8055–9609–1
e-ISBN 978–3–8055–9610–7

Vol. 28: Ascites, Hyponatremia
and Hepatorenal Syndrome:
Progress in Treatment
Editor: Gerbes, A.L. (Munich)
VIII + 212 p., 23 fi g., 31 tab.,
hard cover, 2011
CHF 182.– / EUR 152.– / USD 214.00
ISBN 978–3–8055–9591–9
e-ISBN 978–3–8055–9592–6

Vol. 27: Interventional and
Therapeutic Gastrointestinal
Endoscopy
Editors: Mönkemüller, K. ( Bottrop);
Wilcox, C.M. (Birmingham, Ala.);
Muñoz-Navas, M. (Pamplona)
X + 548 p., 386 fi g., 270 in color,
88 tab., hard cover, 2010
CHF 248.– / EUR 207.– / USD 292.00
ISBN 978–3–8055–9308–3
e-ISBN 978–3–8055–9309–0

Frontiers of
Gastrointestinal Research
A guide to leading investigations in the fi eld of gastroenterology

This series is designed for both the physician active in the clinical practice of gastroenterol-
ogy and the gastroenterologist or student engaged in research. Each volume offers a ready
reference guide to current progress and a review of past achievement in a particular area
of gastrointestinal study. The series covers pathological, pharmacological, diagnostic and
therapeutic considerations relating to the digestive system, as well as the latest techniques
and instrumentation used in the management of gastrointestinal disorders.

KI
1

21
19

Series Editor

C. Sakamoto (Tokyo)

Read it online:
www.karger.com/fgare

Prices subject to change
EUR price for Germany, USD price for USA only

Fax +41 61 306 12 34
E-Mail karger@karger.ch
www.karger.com

© 2012 S. Karger AG, Basel

The Journal Home Page is available at:
www.karger.com/esr

General Information

ISSN Print Edition: 0014–312X
ISSN Online Edition: 1421–9921

Journal Homepage: www.karger.com/esr

Publication Data: ‘European Surgical Research’ is
published 8 times a year. Volumes 48 and 49, each with
4 issues, appear in 2012.

Copyright: © 2012 S. Karger AG, Basel (Switzerland).
All rights reserved. No part of this publication may be
translated into other languages, reproduced or utilized
in any form or by any means, electronic or mechanical,
including photocopying, recording, microcopying, or
by any information storage and retrieval system, with-
out permission in writing from the publisher or, in the
case of photocopying, direct payment of a specified fee
to the Copyright Clearance Center.

Disclaimer: The statements, opinions and data con-
tained in this publication are solely those of the indi-
vidual authors and contributors and not of the publish-
er and the editor(s). The appearance of advertisements
in the journal is not a warranty, endorsement, or ap-
proval of the products or services advertised or of their
effectiveness, quality or safety. The publisher and the
editor(s) disclaim responsibility for any injury to per-
sons or property resulting from any ideas, methods,
instructions or products referred to in the content or
advertisements.

Subscription Rates: Subscriptions run for
a full calendar year. Prices are given per year.
Personal subscription:

Print or Online Print+Online combined
CHF 747.– CHF 843.–
EUR 598.– EUR 674.–
USD 725.00 USD 819.00
postage and handling (added to print and print+online)
CHF 54.40 Europe, CHF 80.– Overseas
EUR 41.60
USD 75.20

Institutional subscription:
Print or Online Print+Online combined
CHF 2490.– CHF 2740.–
EUR 1992.– EUR 2192.–
USD 2418.00 USD 2660.00
postage and handling (added to print and print+online)
CHF 68.– Europe, CHF 100.– Overseas
EUR 52.–
USD 94.00

Airmail surcharge: CHF 68.– / USD 64.00

Back Volumes and Single Issues: Information on
availability and prices of single print issues and print
or electronic back volumes can be obtained from Cus-
tomer Service at service@karger.ch.

Bibliographic Indices: This journal is regularly listed
in bibliographic services, including Current Contents®
and PubMed/MEDLINE.

Photocopying: This journal has been registered with
the Copyright Clearance Center (CCC), as indicated by
the code appearing on the first page of each article. For
readers in the US, this code signals consent for copying
of articles for personal or internal use, or for the per-
sonal or internal use of specific clients, provided that
the stated fee is paid per copy directly to

Copyright Clearance Center Inc.
222

Research

i
Mass Media Law
20th Edition
Clay Calvert
University of Florida
Dan V. Kozlowski
Saint Louis University
Derigan Silver
University of Denver
ii
MASS MEDIA LAW, TWENTIETH EDITION
Published by McGraw-Hill Education, 2 Penn Plaza, New York, NY 10121. Copyright © 2018 by McGraw-Hill Education. All rights reserved. Printed in the United States of America. Previous editions © 2015, 2013, and 2011. No part of this publication may be reproduced or distributed in any form or by any means, or stored in a database or retrieval system, without the prior written consent of McGraw-Hill Education, including, but not limited to, in any network or other electronic storage or transmission, or broadcast for distance learning.
Some ancillaries, including electronic and print components, may not be available to customers outside the United States.
This book is printed on acid-free paper.
1 2 3 4 5 6 7 8 9 LCR 21 20 19 18 17
ISBN 978-1-259-91390-7
MHID 1-259-91390-2
Portfolio Manager: Jamie Laferrera
Product Developer: Alexander Preiss
Senior Marketing Manager: Laura Young
Content Project Managers: Ryan Warczynski, Samantha Donisi-Hamm, Sandra Schnee
Senior Buyer: Sandy Ludovissy
Lead Content Licensing Specialist: Carrie Burger
Cover Image: ©wellphoto/Shutterstock RF
Compositor: MPS Limited
All credits appearing on page or at the end of the book are considered to be an extension of the copyright page.
The Internet addresses listed in the text were accurate at the time of publication. The inclusion of a Web site does not indicate an endorsement by the authors or McGraw-Hill Education, and McGraw-Hill Education does not guarantee the accuracy of the information presented at these sites.
iii
CONTENTS
The American Legal System
The First Amendment: The Meaning of Freedom
The First Amendment: Contemporary Problems
iv
Libel: Establishing a Case
Libel: Proof of Fault
v
Libel: Defenses and Damages
Invasion of Privacy: Appropriation and Intrusion
Invasion of Privacy: Publication of Private Information and False Light

research


Many research psychologists have research teams they work with and some members of the team end up on the publications while others do not. For two months during summer, Ann conducted research as an undergraduate student at a well-known university. She spent long hours in the laboratory injecting mice with opiate blockers to look at pain tolerance. She was responsible for shocking them, as a test for pain tolerance, and euthanizing them at the end of the study. When the article was published months later, Ann was surprised to find her name was only included in a note of thanks. What do you think about this situation?

· Did Ann have a right to be upset, or should she have been grateful for the opportunity? Why?

· Do you think a psychology professor who has published a number of scientific articles is more knowledgeable about the field of psychology as compared to a professor who has not published? Why?

·  Online Library to investigate the significance of the sequence in which authors’ names appear on a paper. Discuss your findings.

· Given that research involves teamwork, do you think that the hierarchical implications of this sequence are appropriate?

Research

1 | P a g e

1 | P a g e

1 | P a g e


GENDER INEQUALITY IN HOSPITALITY INDUSTRY

Submitted on:

Monday, 26 July 2021

By: XXXXXXXXXXXXX Word count:

1190

Submitted to:

Contents
Introduction 3
Impact of geographical location on gender equality 3
Factor influencing gender inequality 4
Impact of access to education on gender inequality 4
A case in the hospitality industry 5
Conclusion 5
References 7
References 8
References 9

Introduction

Gender inequality is a situation whereby one’s gender and sex are determined by the social, cultural, and legal aspects that eventually affect the dignity and rights of men and women (Evans, 2017).

This creates stereotyping assumptions that lead to unequal access and enjoyment of the rights of individuals. Important progress on gender inequality has been made globally over the past decade. For example, there has been increased participation of women and people of color on matters of discrimination, sexual assaults, degradation, and exploitation (United Nations, 2020).

Moreover, the gender roles have also become less rigid with an increasing number of women taking up roles that were once left for their male counterparts (Marsiglia, Kulis and LechugaPeña, 2021). There has also been an increased global awareness brought about by the quantity and quality of data that has resulted in a clear view of gender inequality consequences.

This paper provides an analysis of gender inequality in the hospitality industry. It looks at the impact of geographical location on gender equality, factors influencing gender inequality, the impact of access to education on gender inequality, a case of gender inequality in the hospitality industry, and finally, the conclusion.


Impact of geographical location on gender equality

Gender inequality is not evenly distributed around the world. Some regions have moved closer to attaining millennium development goal number III of gender equality promotion and empowering women relative to others (World Bank, 2011).

A look at the inequality distribution across the globe gives a clear indication that the western jurisdiction has championed for gender equality by countering the violation of the rights of women through the enactment of stringent laws and regulations for offenses related to women, girls, and children (Beghini and Umberto, 2019).

However, in regions that practice Islamic religion, more so the Middle East and the Northern part of Africa there are high incidences of male dominance brought about by perceptions that the progress of women is a western concept, a belief that is given high priority in the sharia laws that govern these Islamic regions (Nadeau and Rayamajhi, 2019).

This prevents women and girls from participating in some activities believe to be preserved for their male counterparts creating a male-dominated society.


Factor influencing gender inequality

Several factors influence gender equality across the globe. One such factor is the level of economic development that has a significant impact on the gender inequality gap (Kochhar, Jain-Chandra and Newiak, 2017). Women in developed countries have increased control of their life with improved access to essential services, advanced technologies and are more educated (Publishing, O and Centre, 2010).

On the other hand, in developing countries, evidence suggests that due to poor economic development, women and girls are deprived of economic knowledge with reduced access to essential services leading to gender bias. Culture is also one factor that influences the extent of inequality among men and women. Women have been marginalized on matters of access, contribution, and participation in cultural and social activities such as arts, cinema, theatre, heritage, and music (Bokova, Shaheed and Deloumeaux, 2014).

This has prevented them from achieving their full potential which eventually impedes inclusivity and sustainability. However, for men, the belief they should be the breadwinners in the family creates discrimination in terms of pay for equal work done by both men and women. This discrimination in terms of wages creates a stereotyping assumption that women are less strong and highly imperfect than men.


Impact of access to education on gender inequality

Education plays a fundamental role in the achievement of sustainable development goals. Education that is quality, inclusive, easily accessible, and equitable creates lifetime opportunities for everyone (OECD, 2017). High gender inequality gaps exist in regions where there is limited access to learning and continuity in education such as in Sub-Sahara Africa, North Africa, and the Middle East (Publishing and OECD, 2012).

On the contrary, regions that promote both formal and informal learning, especially in western countries, experience highly reduced incidences of gender inequality. Empirical evidence suggests that there is a strong correlation between access to quality education among girls and women and increased incidences of gender-based violence.

Societies with high incidences of gender-based educational discrimination experience disparities in areas of health, economic stability among the households, early marriages, reduced involvement of women and girls, and increased frequencies of gender-based violence (UNESCO, 2016).

Whereas, there is improved access to services that are essential including health and advanced technologies in societies that are more educated therefore creating opportunities for women and girls to compete effectively in the labour–market with equal pays for equal level of skills, education, and experiences (OECD, 2017).


A case in the hospitality industry

There are high incidences of gender imbalance in the hospitality industry relative to other industries. Promotion and career advancement are limited for women in this industry with statistics suggesting that there is a ninety percent chance that men will get promoted to top-level positions relative to women (Kumar, Dhiman and Dahiya, 2015).

Moreover, work requirements and structure naturally create pressure on women preventing them from balancing between family and career. The industry is oftentimes characterized by working hours that are irregular and involve frequent traveling and relocation thereby creating a high level of stress for women (Costa, Moura and Mira, 2020).

Despite these challenges, the industry is starting to address these issues to accelerate the creation of a more diverse workforce. One such intervention is the strong encouragement of professionalism against the biasness with regards to women by basing employment on performance as opposed to gender (Jauhari, 2008).

Furthermore, women in the industry are now more than ever being educated on the existing barriers and are given the necessary tools required through improved networking and mentorships. This has an impact on increasing their access to various opportunities and improving their level of influence that is equal to men.


Conclusion

In conclusion, gender inequality as a social, cultural, and legal orientation creates stereotyping assumptions that lead to unequal access and enjoyment of the rights of individuals. The inequality is affected by several factors some of which include geographical location, level of economic development, Culture, and access to education among other factors. In terms of geographical location, some regions have moved closer to attaining the millennium development goal of gender equality promotion and empowering women relative to others.

For economic development, women in developed countries have improved access to essential services, advanced technologies and are more educated than their counterparts in developing countries. Culture, on the other hand, creates inequality since women have been marginalized on matters of access, contribution, and participation in cultural and social activities relative to men.

In my opinion, there are high incidences of gender inequality in the hospitality industry relative to other industries with a high chance that men will get promoted to top-level faster than women. However, the industry is starting to address these issues to accelerate the creation of a more diverse workforce through the creation of awareness on the existing barriers and are giving women the necessary tools required to achieve the level of equality required. This is being undertaken through improved networking and mentorships.


References

Beghini, V., Cattaneo, U. and Pozzan, E., 2019. A quantum leap for gender equality: For a better future of work for all. 1st ed. Geneva: International Labour Office.

Bokova, I., Shaheed, F. and Deloumeaux, L., 2014. Gender equality, heritage and creativity. 1st ed. [ebook] Paris: The United Nations Educational, Scientific and Cultural Organization, pp.14-18. Available at:
http://uis.unesco.org/sites/default/files/documents/gender


equality





heritage





and





creativity





2014





en_1.pdf

[Accessed 29 April 2021].

Costa, V., Moura, A. and Mira, M., 2020. Research on Human Capital and People Management in the Tourism Industry. 1st ed. Business Science Reference.

Evans, M., 2017. The Persistence of Gender Inequality. 1st ed. [ebook] Cambridge: Polity Press, pp.18-23. Available at:


https://books.google.ch/books?hl=en&lr=&id=AWdNDwAAQBAJ&oi=fnd&pg=PR3&dq=E


vans,+M.,+2016.+The+Persistence+of+Gender+Inequality.&ots=XDZfnD1bY6&sig=NGWs


s1MNMHAz3jwVNBNq0rpenBw#v=onepage&q&f=false

[Accessed 29 April 2021].

References

Jauhari, V., 2008. Global cases on hospitality industry. New York, Haworth Press. 1st ed.

Kochhar, K., Jain-Chandra, S. and Newiak, M., 2017. Women, Work, and Economic Growth. 1st ed. [ebook] International Monetary Fund, pp.57-75. Available at:
http://file:///C:/Users/HP/Downloads/[9781513516103%20




%20Women,%20Work,%20and%20Economic%20Growth]%20Women,%20Work,%20an


d%20Economic%20Growth.pdf

[Accessed 30 April 2021].

Kumar, S., Dhiman, M. and Dahiya, A., 2015. International Tourism and Hospitality in the Digital

Age. 1st ed. AHTSI, pp.50-99.

Marsiglia, F., Kulis, S. and Lechuga-Peña, S., 2021. Diversity, Oppression, & Change: Culturally

Grounded Social Work. 3rd ed. pp.77-90.

Nadeau, K. and Rayamajhi, S., 2019. Women and Violence. 2nd ed. Global Lives in Focus, pp.34-

78.

References

OECD, 2017. The pursuit of gender equality: an uphill battle. 1st ed. [ebook] Paris: OECD, pp.4489. Available at:
https://read.oecd





ilibrary.org/social





issues





migration





health/the


pursuit





of





gender





equality_9789264281318





en#page4

[Accessed 31 April 2021].

Publishing, O., and Centre, O. D., 2010. Atlas of Gender and Development How Social Norms Affect Gender Equality in non-OECD Countries. Paris, Organization for Economic Cooperation and Development.

Publishing, and Organization for Economic Co-Operation and Development, 2012. Equity and Quality in Education Supporting Disadvantaged Students and Schools. Paris, OECD Publishing.

UNESCO, 2016. Global guidance on addressing school-related gender-based violence. Paris,

UNESCO.

United Nations, 2020. World Social Report 2020: Inequality in a Rapidly Changing World.

World Bank, 2011. Gender equality and development. Washington, DC, World Bank.

Research

 

Research professional health care associations, such as HIMSS and AHIMA, that address ethical standards.

Using information from your chosen association, write at least a 1,050-word review that describes ethical standards relating to the following:

  • Electronic data access
  • Release of information
  • Reporting procedures and responsibilities
  • Staff and the organization
  • Reporting guidelines for breaches or suspected breaches
  • Proposed possible improvements in ethical standards

RESEARCH

Literature Review due February 26, 2022 by 2355

1. Select a minimum of 5 primary research studies from your literature search. Articles must justify the PICOT.

2. Critically appraise the selected articles. 

3. Synthesize the findings of the articles to come up with a justified conclusion to your PICOT.

4. All references and in-text citations must follow APA guidelines. 

See rubric in Syllabus Supplement for additional information and grading guidelines.

**No late submissions or resubmissions will be allowed. Do your best work the first time. I look forward to reading your papers.**

Research

 Review the changes and challenges a particular religion faces in the modern world. Now, imagine you have gone through some kind of space-time rift and returned five hundred or a thousand years from now. How is the religion, if it still exists, being practiced and conceived?  

Please  write this in a sophisticated, developed, and reflective dialogue between two or more characters. The dialogue should contain ample support or evidence .I need this in 250 words .MLA format. I need this in 14 hours.

    • 5

    RESEARCH

    Literature Review Sample 1.docx

    2

    11

    Patient Violence Against Nursing Staff and De-Escalation Courses: Literature Review

    Name

    NSG 410 Research and Evidence- Based Nursing Practice

    Dr. Coffin

    Patient Violence Against Nursing Staff and De-Escalation Courses: Literature Review

    Overview and Introduction

    Patient violence against nursing staff is an ongoing, and rising, issue in the healthcare field not just in the U.S., but worldwide. According to The Joint Commission (2018), workplace violence (WPV) occurs four times more in nurses in hospital settings than any other worker in the private sector. Nurses working in emergency departments are at the greatest risk of verbal and/or physical assault than any other unit of nursing due in part to being the first point of contact with the patient from the outside (Wong et al., 2015). That being said, WPV still occurs in all nursing fields putting each nurse working bedside at risk. Using meticulous technique, a literature review was conducted using primary sources in the span of several weeks. Search terms such as “violence in nursing”, “workplace violence”, “occurrences”, and “de-escalation training” were combined and inputted into databases such as ProQuest, National Institutes of Health, and CINAHL with additional search terms applied when needed for clarification. The articles that will be discussed in this review were chosen because they are primary sources that moved the discussion forward on solutions to reduce patient violence against nurses. Knowles’ Adult Learning Theory was the theoretical framework used to guide this research with the understanding that adult learning is mainly self-directed and self- motivated, so in order to be able to implement successful education programs, such as that of this intervention, this understanding must be acknowledged (Casey, 2019). Comment by Rebecca Coffin: The problem is clearly presented and data is provided to show the magnitude of the problem Comment by Rebecca Coffin: Search terms are provided Comment by Rebecca Coffin: No need to use a theory to guide your paper, but you are welcome to do so if you wish Comment by Rebecca Coffin [2]: Great introduction!

    Clinical Question

    The clinical research question in focus for this literature review is as follows: Among nursing staff in acute hospital units, what is the effect of de-escalation training courses in reducing the number of violent events compared with learning de-escalation on the job, within 12 months of implementation. Comment by Rebecca Coffin [2]: PICOT

    Appraisal of Articles

    With Knowles’ Adult Learning Theory in mind, articles were chosen that exemplified the integration of adult learning into their interventions. In the article “Management of Aggressive Patients: Results of an Educational Program for Nurses in Non- Psychiatric Settings,” by Casey (2019), a non- experimental one-group, pre-post test design was used to evaluate the effectiveness of an education program that utilized multiple teaching strategies. The study recruited 36 registered nurses from a neurological unit in an adult hospital in southern United States. The program was delivered in a hybrid format over 6 weeks that utilized online presentations as well as in person classroom sessions. In line with the theoretical framework, the researchers utilized case studies to foster critical thinking, face to face role play was used demonstrate and build up de-escalation techniques, and group reflections were used to collectively bring together what was learned. Data was collected using self- reported Likert scale questionnaires that were validated by experts in emergency and psychiatric nursing. Analysis of the data concluded significant improvement in demonstration of preparedness and increased confidence in managing aggressive behaviors through the use of the designed educational program. Comment by Rebecca Coffin [2]: Don’t need to include the title of the article in APA style

    The major limitation of the study was the small sample size not being significant enough to be generalizable. There was also time constraints limiting the amount of time for learning but was necessary in this study to feasibly allow maximum number of participants due to having to work around shift schedules. The researcher in this study recommends expanding similar interventions into other acute hospital units.

    The article, “Reducing conflict and containment rates on acute psychiatric wards: The Safewards cluster randomized controlled trial” by Bowers et al. (2015) implemented 10 carefully selected interventions into a clustered randomized control trial to study its effects on rates of conflict and containment. The study came about from the understanding that there is a need for RCT’s in this topic. The study comprised of 15 psychiatric wards surrounding central London with inclusion criteria being acute psychiatric inpatient wards and were excluded if the wards had any major changes coming up in the course of the 18-month study, if they didn’t have a permanent nurse manager on post, and if the staff vacancy rate was greater than 30%. With these criteria put in place, nurses in the included wards chose to participate bringing the total number of participants to 564 (88% of the potential total). The confidence in this sample size was confirmed in each category with a power analysis. Baseline data was collected for 8 weeks, then participants had 8 weeks to implement the trained interventions, and 8 weeks additional were for observation of the implementation. This study was double blind in that both researchers and participants were unaware of which was the control and which was the intervention. Wards were visited 2-3 times a week by researchers who delivered and collected questionnaires and answered any questions about the interventions in order to ensure strong reliability. Results showed the interventions implemented in the Safewards interventions were significantly effective in reducing patient conflict and containment. Given that the primary source of data collection came from questionnaires, the main limitation of this study was missing data from unsubmitted questionnaires by charge nurses working the participating shifts. After accounting for these deficits however, they concluded that the missing data was not significant enough to shift the findings. The second limitation and recommendation for future research was that the study length was too short of a time period to really see significant change after implementation. Comment by Rebecca Coffin: Good critique! Look for whether a power analysis was performed in quantitative studies Comment by Rebecca Coffin [2]: What effect does this have on the study? Is this a good thing to do?

    This study understood that there was a lack of quantitative research on violence against nurses in the form of randomized control trials, so the research design itself was created with the hopes of being the trailblazers for future research to continue RCT’s in the study of this concept. By explicitly highlighting each limitation set forth in their study, they were able to use their limitations to pave the path for future research.

    In the study “Educational and Managerial Policy Making to Reduce Workplace Violence Against Nurses: An Action Research Study” Hemati- Esmaeili et al. (2018), look beyond education at the bedside nurse level to go a step up the ladder to include managerial interventions. This study took place in Iran but many issues presented in this study are parallel universally to many other hospital settings. With a sample size of 44 nurses confirmed by a p value test, a workplace violence prevention program was developed in conjunction with the development of a new nursing position called the violence prevention nurse, whose role was to screen patients and their families upon arrival to the hospital for potentially aggressive behaviors. Careful analysis using SPSS software analyzed the results of the self-report surveys and focus groups and concluded that the implementation of the program significantly reduced fear associated with these violent events because the nurses felt more prepared to handle them. This study went a step further than the previously discussed studies by including a managerial intervention where a protocol was put in place of how to take care of staff who had been attacked. Comment by Rebecca Coffin [2]: Good point to highlight!

    This study did an excellent job of highlighting the need for interventions that are individualized to each unique unit. They explained that many aspects of the design, such as altering the questionnaire scales used to better suit Iranian culture, was a big step in improving fidelity in the study because the nurses could answer more accurately. Unique to this study and also not included in the previously mentioned studies, was a follow up survey four months after conclusion of the study. Researchers could still see strong evidence of the interventions being implemented. Follow up studies should be included in future research in this topic to measure long term effects. Comment by Rebecca Coffin [2]: That is a good thing to do to check how long the effect lasts

    The study “Coordinating a Team Response to Behavioral Emergencies in the Emergency Department: A Simulation- Enhanced Interprofessional Curriculum further enhance the findings from all the previously mentioned studies by integrating teamwork into simulation scenarios using larger sample sizes. Wong et al. (2015) hoped that through implementation of an interprofessional curriculum into simulation enhanced education, teamwork and staff attitudes toward patient violence would improve. Ten 3-hour simulation sessions were conducted for this study. In the simulation, formal roles were predetermined, meaning each member of the healthcare team knew exactly what their roles were immediately once a violent event was occurring. The study recruited 162 ED staff members. Surveys used to collect data were published from a British nursing education group that showed reliability and internal validity. Data collected was reflective of participant’s changing attitudes through the duration of the course. Risk for bias in response was present though in that evaluators of the program were in leadership positions within the participating department, which may have confounded responses with staff members answering in responses favorable to the evaluators. As was the main theme with all the studies discussed thus far, the main limitation of the study was time constraints and lack of longitudinal data. Comment by Rebecca Coffin: Another great critique!

    Given the emotional magnitude of this research topic, it was necessary to include a qualitative study into this review to increase the magnitude of its relevance to the nursing profession and place further emphasis that research in this field is what the people directly involved want. The qualitative phenomenological study “The Patient Care Paradox: An Interprofessional Qualitative Study of Agitated Patient Care in the Emergency Department” by Wong et al. (2016), took their research further from the previously discussed study to look at the experience of these healthcare workers to provide a broader perspective of ED patient violence. Convenience, but purposive, sampling was used to recruit participants. This study took careful measures to reduce bias in all aspects of the study. For example to balance out and decrease bias during data collection, the research team consisted of 2 board certified ED physicians, but also 2 nurses working outside of the ED (palliative and midwifery) so as to maintain an insider/ outsider approach and to bracket potential personal biases which could have skewed the data collection. In the research design, 1 member of the research team with no prior relationships to any of the participants was trained for qualitative data collection while another member assisted in equipment setup and took field notes. The interview process was standardized and data was cross-checked. Interview responses and focus group discussions were all recorded, transcribed, and later professionally transcribed by a third party. In this study, data saturation was reached at 31 participants. Comment by Rebecca Coffin: Spell out “two” Comment by Rebecca Coffin: Here also, “two” should be spelled out Comment by Rebecca Coffin [2]: Spell out numbers <10 per APA style Comment by Rebecca Coffin [2]: Good!

    Three themes were discovered as a result of these interviews. The first is the patient care paradox: that in the process of providing high- quality care for these potentially aggressive patients, staff are putting themselves at greater risk of a violent incident, and finding a balance is not easy. Under this theme, direct quotes were included that talked about injuries many of the participants sustained as a result of trying to provide quality care. The second theme was that teamwork is key to resolution of a violent situation, however, pre-existing conflicts up the linear ladder of command make it hard to fluidly work as a team. In this particular hospital, quotes were included that talked about how techs can’t do anything to de-escalate a situation unless the nurse is involved, and the nurse can’t prophylactically prevent a violent incident unless he/she gets orders from a doctor, and it causes delay in action when not all members are on the same page. The third theme was environmental factors that further exacerbate aggressive behaviors such as lack of privacy, volume of people. The main limitation of this study is that while data saturation was reached, this data may not be generalizable to all ED’s because it was conducted in a heavy volume, urban ED in New York City. Researchers also stated that descriptions of patient population were reliant on descriptions from participants and not confirmed with demographic statistical data, thus increasing the likelihood of personal and recall bias. Comment by Rebecca Coffin [2]: Fantastic review of the articles! The articles were relevant to the PICOT and you captured all the highlights

    Conclusion

    A literature review was conducted using five primary sources to examine the effect of de-escalation courses and interventions on patient violence against nursing staff in acute hospital units. Across each article presented in this literature review was the same recurring theme: change needs to occur to decrease the rate of patient violence against nurses and healthcare staff. The articles in review were not limited to the United States to allow a comparison of occurrence of patient violence worldwide. The similarities in research topic of each of these articles is enough to attest to the ongoing need for a long-lasting intervention. Each article highlighted that this is a significant problem that is only getting worse with time. Each article was able to recognize that any intervention showed improvements than no intervention. Comment by Rebecca Coffin [2]: Was there one intervention that was better than others? Why or why not?

    Limitations encountered in the search for literature included a saturation of studies conducted in emergency departments and psychiatric wards. The study by Casey (2019) was conducted in an adult neurological unit but even in their discussion they explained how they borrowed scales more suited for emergency departments. Another limitation noted in these studies was that no matter what statistical data is published on rates of workplace violence in nursing, the number is always higher because there is always the incidences that don’t get reported. One strength of these studies was their use of self-report data collection to foster an outlet for these nurses and healthcare workers to have their thoughts heard that they might otherwise have been too scared to report for fear of job security or backlash. The limitation of time led to many gaps and inconsistencies in the results of a number of these studies. For example, the articles by Wong(year) and Bowers (year)both explained how implementing a new protocol for an entire hospital unit is a very time- consuming task in and of itself. They both explained how by the time their interventions were taught at the level suitable to continue on with the study, weeks had already gone by. In both discussions, it was highlighted that longer time for data collection would have allowed more significant results. Research must continue on this topic for the improvement of the nursing field as a whole. Comment by Rebecca Coffin [2]: Not surprising, I’m sure! Comment by Rebecca Coffin [2]: Yes but what do we know about the limitations of self-report? Comment by Rebecca Coffin [2]: Nicely done! I think you could have had a more definitive conclusion, but you did a great job in comparing / contrasting the studies overall


    References Comment by Rebecca Coffin: References are formatted per APA guidelines

    Bowers, L., James, K., Quirk, A., Simpson, A., Stewart, D., & Hodsoll, J. (2015). Reducing conflict and containment rates on acute psychiatric wards: The Safewards cluster randomized controlled trial. International Journal of Nursing Studies, 52(9), 1412-1422.

    Casey, C. (2019). Management of aggressive patients: Results of an educational program for nurses in non-psychiatric settings. MEDSURG Nursing, 28(1), 9-21.

    Hemati-Esmaeili, M., Heshmati-Nabavi, F., Pouresmail, Z., Mazlom, S., & Reihani, H. (2018). Educational and managerial policy making to reduce workplace violence against nurses: An action research study. Iranian Journal of Nursing and Midwifery Research23(6), 478–485. https://doi.org/10.4103/ijnmr.IJNMR_77_17

    The Joint Commission. (2018). Physical and verbal violence against health care workers. Sentinel Event Alert.

    Wong, A. H., Wing, L., Weiss, B., & Gang, M. (2015). Coordinating a team response to behavioral emergencies in the emergency department: A simulation- enhanced interprofessional curriculum. The Western Journal of Emergency Medicine, 16(6), 859-865.  https://doi.org/10.5811/westjem.2015.8.26220

    Wong, A. H., Combellick, J., Wispelwey, B.A., Squires, A., & Gang, M. (2016). The patient care paradox: An interprofessional qualitative study of agitated patient care in the emergency department. Academic Emergency Medicine, 24(2), 226-235. https://doi.org/10.1111/acem.13117

    Literature Review Sample 2.docx

    Running Head: LITERATURE REVIEW 1

    LITERATURE REVIEW 6

    Literature Review

    Stratford University

    Introduction Comment by Rebecca Coffin: Good introduction, used a statistic to support why hand-washing is important in school-age children. This could be more powerful in grabbing the reader’s attention with additional statistics and better describing the relationship between the variables.

    Keeping the hands clean and proper handwashing, are some of the most important steps to take to avoid getting sick and spreading germs to others (CDC, 2017). Keeping that in mind, absenteeism is a growing problem among school-aged children, with approximately 75% of all school absences attributed to illness (Lau et al., 2013). Hand washing is of great importance in this matter, but the role of instruction is far less obvious. The purpose of this literature review, is to evaluate five research articles that focus on the importance of hand washing education, and its relation to illness-related absenteeism among school-age children. My article search was done by use of Medline/PubMed Resources and ProQuest, using keywords, hand hygiene, illness-related absenteeism, and childhood illness prevention. Comment by Rebecca Coffin: Good!

    Clinical Question

    In District of Columbia Public School students, grades K-4, what is the effect of a comprehensive handwashing program (handwashing education and use of hand sanitizer), compared with no comprehensive handwashing program, on the rate of illness-related absenteeism, within 3 months.

    Appraisal of Articles

    The first article, “Effectiveness of Hand Hygiene Intervention in Reducing Illness Absence Among Children in Educational Settings, by Wilmott et al., is a systematic review and meta-analysis study, done to establish the effectiveness of handwashing in reducing absence among school-aged children. Specifically, the study took an in depth look at the spread of respiratory tract and gastrointestinal infections, and their frequency among children and/or staff in the educational setting. Interventions in this study, consisted of education with a hand hygiene component, which involved eighteen cluster RCT’s of 13 school-based and 5 child day care facilities (Wilmott et al., 2015). Results of the teaching suggested that interventions may reduce children’s absences, although randomization was inadequate. The study was not well executed or reported, despite an updated existing systematic review, which found that identifying new studies relating evidence of the effect of hand hygiene interventions on absenteeism, would need to be more robust (Wilmott et al., 2015). Comment by Rebecca Coffin [2]: No systematic reviews allowed in this assignment Comment by Rebecca Coffin [2]: What does this mean?

    The second article, “The Impact of Common Infections on School Absenteeism During an Academic Year,” by Azor-Martinez et al., is a randomized, controlled open study, which focused on the assessment of the impact of infections on school absenteeism, and their reduction with a handwashing program using hand sanitizer (Azor-Martinez, 2014). The study, which took place over an 8-month time frame, consisted of an experimental group of 4-12-year-olds, who washed hands with soap and water, complemented with hand sanitizer. There was also a control group that followed usual handwashing protocol. It was found that the percentage of missed days due to upper respiratory infections and GI infections, were significantly lower in the experimental group, during a flu period (Azor-Martinez, 2014). Researchers determined that this approach was effective, due to full participation of students and staff. Comment by Rebecca Coffin: Don’t need to refer to article by the title of the article. Just follow APA and cite the authors and date.

    The third article, “Comparative efficacy of a simplified handwashing program for improvement in hand hygiene and reduction of school absenteeism among children with intellectual disability,” by Lee et al., is a quasi-experimental study, which purpose is to test the feasibility and sustainability of a simplified 5-step handwashing technique, to measure the hand hygiene outcome for students with mild intellectual disability. An intervention group of 20 students underwent pre and post testing using available social learning factors, a multimedia approach, and fluorescent stain rating tests to assess handwashing quality. Results from the intervention group, showed that there was significant increase in the rating of handwashing quality in both hands of each student (Lee et al., 2015). Students in this study showed better performance in simplified handwashing techniques, and experienced lower absenteeism than using usual practice (Lee et al., 2015). Comment by Rebecca Coffin: Where’s the date!?!? Comment by Rebecca Coffin [2]: What type of testing?

    The fourth article, “Effect Evaluation of a Randomized Trial to Reduce Infectious Illness and Illness-related Absenteeism Among School children: The Hi Five Study,” by Denbaek et al., evaluates whether a school-based multicomponent intervention would improve handwashing among schoolchildren, and succeed in reducing infectious illness and illness-related absenteeism in schools (Denbaek et al., 2018). The multicomponent intervention used in this study, is called The Hi Five study, a three-armed cluster-randomized controlled trial. It involved 43 randomly selected schools in Denmark (half control, half intervention), in which parents were educated and surveyed via text message, regarding proper handwashing. A questionnaire was also administered to school children, regarding handwashing practices at home and school (Denbaek et al., 2018). Mandatory daily handwashing was also implemented before lunch. A follow-up showed that intervention schools did not differ from control schools, in number of illness days, and that the multicomponent intervention achieved no difference in the number of illness day, illness episodes, or illness-related absences among children (Denbaek et al., 2018). Comment by Rebecca Coffin [2]: What type of questionnaire? Did it demonstrate validity/reliability?

    The fifth article is, “Hand hygiene instruction decreases illness-related absenteeism in elementary school: a prospective cohort study,” by Lau et al. The purpose of this study was to compare absenteeism rates among elementary students, who were given access to hand hygiene facilities versus being given both access and short repetitive instruction (Lau et al., 2013). During one academic year, students in an intervention group and control group, were systematically assigned. Intervention students were given short repetitive instruction in hand washing every 2 months, where the control was only given access to hand washing facilities (Lau et al., 2013). Percentage of absent days were calculated, and bivariate analyses were performed to compare percent absent days of students given access to hand hygiene facilities, versus those given instruction and access (Lau et al., 2013). Participants were fully compliant, and results showed that total absent day and illness-related absences were significantly lower in the group receiving short instruction and access (Lau et al., 2013). Comment by Rebecca Coffin [2]: These summaries are succinct, but there is not much analysis/critique going on here

    Conclusion

    Each of the articles that I have listed were similar, in that they are primary sources, had one common goal, to factor in the importance of proper handwashing, through education and active participation, to lower the rate of illness-related absenteeism among school-age children. All but one of the studies consisted of randomization sampling, which was “Comparative efficacy of a simplified handwashing program for improvement in hand hygiene and reduction of school absenteeism among children with intellectual disability.” The only inconsistencies present are with the study titled, “Effectiveness of hand hygiene interventions in reducing illness absence among children in educational settings.” This study was not generally well executed or reported, due to the young age of some of the participants, lack of cooperation, and quality issues including small numbers of clusters/participants, which resulted in inadequate randomization (Wilmott et al., 2015). Comment by Rebecca Coffin: Don’t use the title of the article when referring to it – that does not follow APA style. Use the author name and year. Comment by Rebecca Coffin: Where is the answer to the question? You should be attempting to answer the question in this section by analyzing and synthesizing the strengths and weakness of the articles that were previously described. This section is worth 25 points, so make sure the content reflects that.

    References
    Azor-Martinez, Gonzalez-Jimenez, Seijas-Vasquez, Carrascosa, & Santisteban-Martinez. (2014). The Impact of Common Infections on School Absenteeism During an Academic Year. American Journal of Infection Control, 632-637.
    Centers for Disease Control and Prevention. (2017). Clean Hands Count for Safe Healthcare. Retrieved from Centers for Disease Control and Prevention: https://www.cdc.gov/features/handhygiene/index.html
    Denbaek, Andersen, Bomnesen, Laursen, & Johansen. (2018). Effect Evaluaion of a Randomized Trial to Reduce Infectious Illness and Illness-related Absenteeism Among Schoolchildren: The Hi Five Study. Pediatric Infectious Disease Journal.
    Lau, Springston, Sohn, Mason, Gadola, Damitz, & Gupta. (2013). Hand Hygiene Instruction Decreases illness-related Absenteeism in Elementary Schools: A Prospective Cohort Study. BMC Pediatrics.
    Lee, Leung, Tong, Chen, & Lee, H. (2015). Comparative Efficacy of a Simplified Handwashing Program for Improvement in Hand Hygiene and Reduction of School Absenteeism among Children with Intellectual Disability. American Journal of Infection Control, 907-912.
    Wilmott, Nicholson, Busse, MacArthur, Brooker, & Campbell. (2015). Effectiveness of Hand Hygiene Intervention in Reducing Illness Absence Among Children in Educational Settings. BMJ Journal: Archives of Disease in Childhood.

    RESEARCH

    Literature Review

    Virginia Nzolewane

    Stratford University

    NSG 410: Research and Evidence-Based Nursing Practice.

    12/4/2021

    Dr. Karen Benson

    Introduction

    Clinical research in nursing is conducted to investigate a specific issue. In any research, theoretical framework provides support and justification for the research problem. For this particular case, Dorothea Orem’s theory of self-care deficit serves as the theoretical framework upon which the literature review will be based. Self-care, theory of nursing systems, and the concept of self-care deficit were used to identify the need of the patients (Aga et al., 2019). In the theory of self-care, Dorothea Orem defines self-care as the daily living activities that can be done as an individual to maintain one’s well-being. In this stage the individual should be able to understand their level of functioning such as being able to be independent. This self-care is usually carried out to fulfill self-care requisites (such as universal, self-developmental and health) (Smith, 2019). A patient will be considered in self-care deficit if any of the aforementioned self-care requisites are lacking. The self-care deficit simply indicates that there is a need, and this need will necessitate the use of nursing systems to provide care. This care can either be carried out by a provider or care giver depending on the degree of the deficit the individual is presenting with. Nursing systems will also be used to evaluate care provided to measure if the goals were met.

    The research question is; Does lifestyle modification improve clinical health outcomes in hypertension management?

    The chosen population already has a deficit. This deficit is hypertension, and the plan is to educate the chosen population about the advantageous effects that lifestyle modifications has compared to pharmacological therapy in managing hypertension. Orem’s nursing process will be used to guide this research. Orem’s nursing process follows the following steps:

    · Assessment – In this step, the provider will gather the patient’s history. Within the gathered history, lifestyle habits questions will also be gathered (e.g. medication regimen compliance, diet and exercise regimen).

    · Diagnosis – The information compiled from the assessment above will help the provider arrive at a diagnosis.

    · Plan – Here, the provider comes up with a plan of action which is also known as the care plan. This plan includes the procedural tactics to achieve the goals that will be set by the patient and the provider.

    · Implementation – During this step, the plan mentioned above will be set into motion.

    · Evaluation – Finally, the entire nursing practice is evaluated. This process is also done during the implementation phase to make changes.

    In conducting this literature review, Google Scholar was used to search for articles related to this PICOT question. Specifically, this literature review aims to answer: does lifestyle modification improve clinical health outcomes in hypertension management?

    Key words used: blood pressure, hypertension, dietary therapy, physical activity, pharmacotherapy, digital therapeutics, lifestyle modification, ambulatory blood pressure, home blood pressure.

    Literature Review

    Hypertension (also known as high blood pressure) is a condition in which the pressure of the blood in the vessels is higher than normal. High blood pressure is also known as the silent killer; high blood pressure is a prevalent and dangerous condition. This condition can be known as the silent killer because many individuals with hypertension are asymptomatic until the condition progresses to a stroke, kidney failure, or heart failure (Centers for Disease Control and Prevention [CDC], 2019). This can be prevented or well managed through diet, exercise and adherence to treatment regimen. Two of the top causes of mortality in the United States are heart disease and stroke, which can be caused by uncontrolled hypertension. One out of every three adults (about 75 million people in the United Sates) has been diagnosed with hypertension and only 50% of these individuals have controlled hypertension. In 2013 alone, approximately 360,000 deaths were reported from hypertension (CDC, 2019). Therefore, 29% of adults in the United States have hypertension; men (30.2%) have slightly higher hypertension prevalence than women (27.7%). Hypertension becomes more common with the aging population; 63.1% of individuals with hypertension are aged 60 years or older, while 33.2% of adults with hypertension are in the 40-59 age group. Adults between the ages of 18-39 have a prevalence of 7.5%. (CDC, 2019). Hypertension has become a public health issue due to the increment in incidence and prevalence; with this continuous increase, it has been estimated that in 2025 one out of three people will be diagnosed with this disease (Ashoorkhani et al., 2018).

    A trial overview carried out by Ozemek et. al. (2020) sought to assess the value of exercise and diet in lowering blood pressure in patients with resistant hypertension. In this trial, a randomized sampling of one hundred forty patients with a mean age of 63 years diagnosed with resistant hypertension were separated into a group that delivered lifestyle intervention through a center-based cardiac rehabilitation facility (C-LIF) and another group that underwent standardized education and physician advice (SEPA). The DASH (Dietary Approaches to Stop Hypertension) diet was mentioned as one of the recommended food intake plans to help manage resistant hypertension. The investigation revealed that reduction in clinic systolic blood pressure was greater in patients under C-LIF compared to SEPA. 24-hours ambulatory systolic blood pressure was also reduced in C-LIF with no reported change in patients under the SEPA group. While hypertension is a condition that can vary among different people, it was shown in this study that a regulated program of diet and exercise can lower blood pressure in patients with resistant hypertension. This literature is vital in the improvement of discourse about patient education and hypertension management since it suggests ways of improving the care that the nursing service seeks to provide (Ozemek et. al., 2020).

    A descriptive cross-sectional study done in Kenya by Kimani et. al. (2020) investigated the association of lifestyle modification and pharmacological adherence among patients with hypertension in a national referral hospital. 229 patients diagnosed with primary hypertension were chosen at random for this study. The study found that respondents on antihypertensive medication that also engaged in healthy lifestyle and had proper adherence to medication had lower mean blood pressure than those only on medication. The study also showed that ageing, being female, having fast food and animal fat intake were associated with missed blood pressure targets and hypertension-related complications. Pharmacological interventions for hypertension are used in healthcare, but there is great emphasis on non-pharmacological approaches such as lifestyle modifications. Lifestyle modifications (such as diet and exercise) can be implemented to prevent hypertension in pre hypertensive patients, and these lifestyle modifications can be implemented as an adjunct therapy or primary therapy in hypertensive patients prior to drug therapy initiation. This study was limited in its cross-sectional design and by the restriction of assessing lifestyle choices (e.g., smoking, alcohol consumption) to just one point in time might have contributed to gaps in the study about the association of lifestyle modifications and hypertension management (Kimani et. al., 2020).

    Other risk factors related to hypertension were also studied in a quantitative, epidemiologic, and cross-sectional research design by Guptha. (2021). Specifically, the study examined the effect of National Institute of Health and Clinical Excellence and American Diabetes Association consensus adjusted BMI on the risk of T2DM in a representative sample of ~ 6,000 Asian Indians to narrow the knowledge gap and achieve population specificity. It was shown that both lifestyle changes and medical treatment were beneficial and had a significant effect on hypertension management.  This study fills in the knowledge gaps about reducing systolic and diastolic BP and the decrease of cardiovascular risk by non-pharmacological (lifestyle measures) as well as pharmacological means. Like the previous cross-sectional study, this research was also limited to this design in which hidden biases might have emerged and confounded the variables and its results in the study. The study did not also include respondents from rural areas, which is where more than half of the people in India reside, possibly limiting the extrapolation of results to only urban regions of India and risking misrepresentation of the target population (Guptha., 2021).

    To further expound the effect of nonpharmacologic treatment, a Bayesian network meta-analysis by Fu et. al. (2020) was reviewed and showed that nonpharmacologic interventions, including dietary approaches, are a cornerstone for the prevention and treatment of hypertension. A total of 60,166 articles were identified in the initial systematic search, and 888 potentially eligible articles were narrowed down and retrieved as full text. Overall, 120 articles (corresponding to 126 randomized controlled trials) with 14,923 participants met the inclusion criteria and were included in the network meta‐analysis. This study affirms that DASH is a potent effector in modulating dietary changes and decisions of patients with hypertension. However, the study reported only the effectiveness of nonpharmacologic interventions in lowering BP, lacking secondary end points such as rate of BP control, incidence of hypertension, and mortality due to complications of hypertension. In addition, upon further review of this meta-analysis, it was found that only 8 interventions were only directly compared with usual care. Smoking as a lifestyle risk factor was excluded from this study because existing randomized controlled trials on smoking cessation in patients with hypertension or prehypertension were not truly implemented. This network meta‐analysis showed that, among 22 nonpharmacologic interventions, DASH was the most effective intervention in lowering BP for adults with prehypertension to established hypertension. Aerobic exercise, isometric training, low‐sodium and high‐potassium salt, comprehensive lifestyle modification, breathing control, meditation, and low‐calorie diet also have obvious effects in lowering BP. Moreover, the findings suggest that salt restriction be used for lowering BP, especially in patients with hypertension (Fu et. al., 2020).

    Rounding out this literature review is a randomized, open-label HERB-DH1 study by Kario et. al. (2021) which showed that the HERB-DH1 pivotal study showed the superiority of digital therapeutics compared with standard lifestyle modification alone to reduce 24-h ambulatory, home, and office BPs in the absence of antihypertensive medications. All 390 respondents were 20-64 years old (mean age range of 52-52.4)) and diagnosed with essential hypertension were randomly grouped into the digital therapeutics group and the control group. Digital therapeutics is a novel approach to managing non-pharmacological treatment of hypertension. The HERB system helps the user to make lifestyle modifications to reduce BP by the use of an interactive smartphone app. For the duration of the study, pharmacological interventions were prohibited and discouraged with physician monitoring so as to avoid confounding the results. Being a pilot study, the research was limited to the variables that could be studied and numerous knowledge gaps were identified. The time period of monitoring BP change through non-pharmacological methods was also inadequate (12 weeks) to properly determine whether the lifestyle modifications were able to provide significant change to the patient’s blood pressure (Kario et. al., 2021).

    Conclusion

    Conducting this literature review gave me the opportunity to peruse various sources for the evaluation of non-pharmaceutical methods in managing hypertension among patients 40-70 years of age. I realized that the worldwide disease burden of hypertension is too big to ignore and has become a significant public health issue over the decades. With more and more people becoming obese and acquiring hypertension and hypertension-related complications, it is imperative to study and research about the protocols that can be put in place to mitigate this condition. It must also be noted that medications alone will not have a significant effect. The patient must be able to make health decisions on their diet, exercise, and other lifestyle choices by being well-informed, and this patient education begins with the nurse at the helm of the care team as a patient advocate.

    Better designed researches must also be conducted to fill in the gaps of knowledge established by prior researches. The studies reviewed here had similarities other than the inclusion criteria of having a respondent diagnosed with hypertension, the studies also were designed to study multiple therapeutic approaches to gain a better insight. Overall, the weaknesses of the studies, other than the ones detailed in the literature review above, was only prominent in descriptive and cross-sectional studies, as the variation in research variables can be significant enough to affect the results of the study. The level of scientific evidence must also be taken into account when designing a research study, wherein the most apt and highest yield study design must be chosen.

    References

    Ademe, S., Aga, F., & Gela, D. (2019). Hypertension self-care practice and associated factors among patients in public health facilities of Dessie town, Ethiopia. BMC health services research, 19(1), 1-9.

    Fu, J., Liu, Y., Zhang, L., Zhou, L., Li, D., Quan, H., … & Zhao, Y. (2020). Nonpharmacologic interventions for reducing blood pressure in adults with prehypertension to established hypertension. Journal of the American Heart Association, 9(19), e016804.

    Guptha, L. S. (2021). A Cross-Sectional Epidemiology Study of the Relationships between Body Mass Index and the Risk of Diabetes, and Diabetes and the QRISK2 10-Year Cardiovascular Risk Score Using India Heart Watch Data (Doctoral dissertation, Trident University International).

    Hypertension. (2019). Retrieved from https://www.cdc.gov/bloodpressure/index.html

    Kario, K., Nomura, A., Harada, N., Okura, A., Nakagawa, K., Tanigawa, T., & Hida, E. (2021). Efficacy of a digital therapeutics system in the management of essential hypertension: the HERB-DH1 pivotal trial. European heart journal, 42(40), 4111-4122.

    Kimani S, Mirie W, Chege M, et al (2020) Association of lifestyle modification and pharmacological adherence on blood pressure control among patients with hypertension at Kenyatta National Hospital, Kenya: a cross-sectional study BMJ Open 2019;9:e023995. doi: 10.1136/bmjopen-2018-023995

    Ozemek, C., Tiwari, S., Sabbahi, A., Carbone, S., & Lavie, C. J. (2020). Impact of therapeutic lifestyle changes in resistant hypertension. Progress in cardiovascular diseases, 63(1), 4-9.

    Smith, M. C. (2019). Nursing theories and nursing practice. FA Davis.

    research

     

    Many research psychologists have research teams they work with and some members of the team end up on the publications while others do not. For two months during summer, Ann conducted research as an undergraduate student at a well-known university. She spent long hours in the laboratory injecting mice with opiate blockers to look at pain tolerance. She was responsible for shocking them, as a test for pain tolerance, and euthanizing them at the end of the study. When the article was published months later, Ann was surprised to find her name was only included in a note of thanks. What do you think about this situation?

    • open attachment 

    RESEARCH

    July-August 2013 • Vol. 22/No. 4246

    Kimberly Foisy, MSN, RN, CMSRN, is Clinical Educator/Administrative Nursing Supervisor,
    Orthopedic-Neurological Medical/Surgical Unit, North Shore Medical Center (NSMC), Salem
    Hospital, an affiliate of Partners Healthcare System Inc.; and Assistant Professor, Massachusetts
    College of Pharmacy and Health Sciences, School of Nursing, Boston, MA.

    Acknowledgment: The author gratefully acknowledges Kathy Clune, MSN, RN, Nurse Manager,
    Phippen 6 and 7; and Taryn Bailey, MSN, RN-BC, Executive Director, Professional Practice and
    Patient Education Services, for their advice and guidance in the development of this article.

    Thou Shalt Not Fall! Decreasing Falls
    In the Postoperative Orthopedic

    Patient with a Femoral Nerve Block

    N
    orth Shore Medical Center
    (NSMC), Salem Hospital, an
    affiliate of Partners Health –

    care System Inc., is a 250-bed acute
    care teaching hospital located in
    Salem, MA, near Boston. The hospital
    serves a diverse patient population
    with 12,000 inpatient admissions per
    year. The hospital’s 32-bed orthope-
    dic-neurologic inpatient unit, which
    is split between the 6th and 7th
    floors of the Phippen Building, has
    an average daily census of 30
    patients. Unit leadership includes a
    nurse manager, clinical educator,
    unit coordinator, and one day-shift
    charge nurse assigned to both floors.
    Average daily staffing consists of
    three nurses, two nursing assistants,
    and a service associate for each 16-
    bed unit; staff can be assigned to
    either floor.

    Improvement Needs
    Decreasing patient falls is a

    patient safety priority for direct-care
    nurses. Many regulatory and govern-
    mental agencies, such as the Centers
    for Medicare & Medicaid Services
    (CMS), have set standards and pay-
    ment incentives to reduce or elimi-
    nate falls in the health care setting.
    For example, CMS (2011) no longer
    reimburses for hospitalization if a
    patient has an injury as a result of an
    inpatient fall. Some health care
    providers suggest falls cannot be
    avoided (Muraskin, Conrad, Zheng,
    Morey, & Enneking, 2007). However,
    staff members for the involved units
    at NSMC were determined to count-
    er this view by taking action to
    address a recent increase in patient
    falls on the unit.

    Phippen 6 and 7 house postoper-
    ative orthopedic and neurological

    surgical patients. Each floor has 16
    private beds. A group of multidisci-
    plinary professionals and unlicensed
    staff from the two units convened to
    form a team under the Transitioning
    Care at the Bedside (TCAB) model
    (Rutherford, Moen, & Taylor, 2009).
    The team set a goal to eliminate falls
    on the unit and started analyzing
    falls data to determine the rate and
    cause of falls that were occurring.
    Data revealed as many as three falls
    per month associated with femoral
    nerve blocks (FNBs), with two
    patients sustaining injury from
    January to July 2009. The unit had a
    fall rate of 5.2 per 1,000 patient days,
    compared with a fall rate of 3.43 per
    1,000 patient days for the facility.
    Further data analysis showed 5 of 30
    falls reported during that time
    occurred in patients with a femoral
    nerve block in place following knee
    arthroplasty.

    A process flow analysis revealed
    the nursing practice protocol recent-
    ly had been replaced by a standard
    computerized nursing order set that
    did not include assessment parame-

    ters for the patient or a plan of care.
    Furthermore, the signs at the head of
    the patients’ beds stating “Fall Risk
    Femoral-Nerve Block” were being
    removed as soon as the FNB was dis-
    continued. A learning needs assess-
    ment demonstrated nursing assis-
    tants did not have adequate knowl-
    edge of the definition, purpose, and
    precautions needed in caring for a
    patient with a current or recently
    discontinued femoral nerve block. In
    addition, patients and families were
    not aware of the safety risks needed
    during and after the use of a contin-
    uous femoral nerve block.

    Literature Review
    Two searches of the CINAHL data-

    base were performed to identify best
    practices (June 2009; May 2011) for
    literature of the preceding 6 years.
    The terms searched included femoral
    nerve block, falls, and orthopedic sur-
    gery. The search revealed no pub-
    lished nursing literature that demon-
    strated a decrease in falls in persons
    with femoral nerve blocks after an

    Advanced PracticeAdvanced Practice

    Kimberly Foisy

    A Transforming Care at the Bedside model was used to decrease
    falls in the femoral nerve block (FNB) patient population on a 32-
    bed orthopedic/neurologic unit in a community hospital setting.
    A multifaceted, strategic practice and educational bundle was
    implemented, resulting in a 75% decrease in falls among patients
    with FNB.

    July-August 2013 • Vol. 22/No. 4 247

    educational intervention was imple-
    mented to nursing staff. Results of
    two medical studies are described in
    the following paragraphs.

    Sharman, Iorio, Specht, Davies-
    Lepie, and Healy (2010) reported
    patients with a FNB have a shorter
    length of stay. According to these
    authors, patients ambulate earlier as
    a result of the comfort maintained
    with the block. A large percentage of
    postoperative falls among this group
    of patients have quadriceps weak-
    ness as a contributing factor.

    Continuous FNB provides effec-
    tive pain management as an anal-
    gesic adjunct to other modalities for
    orthopedic patients. A FNB reduces
    the required doses of general anes-
    thetic agents and hence their side
    effects, including nausea, vomiting,
    drowsiness, and respiratory depres-
    sion. The FNB also confers superior
    pain management, decreases opioid
    requirements, and enables earlier
    ambulation and hospital discharge
    (Atkinson, 2008). The use of FNB
    with general anesthesia also places
    the patient at a higher risk for falls.

    A continuous FNB is used as an
    anesthetic. A catheter is placed just
    below the skin surface, next to the
    femoral nerve. The catheter coats the
    nerve with anesthetic, blocking
    transmission of neuronal messages
    and creating a feeling of localized
    numbness for the patient (Kasibhatia
    & Russon, 2009). This block allows
    the patient to achieve more effective
    pain management. The block does
    not alleviate the pain on the posteri-
    or portion of the knee. An adjunct
    therapy, such as patient-controlled
    analgesia, often is prescribed for this
    reason. Because the block causes a
    weakness of the quadriceps muscle,
    the patient needs assistance with
    every transfer (Atkinson, 2008).

    One of the cases analyzed by the
    team involved a patient who was
    ambulating with a nursing assistant.
    The continuous femoral nerve block
    had been discontinued 2 hours earli-
    er. The patient’s knee buckled, and
    he proceeded to fall to the floor. The
    nursing assistant hit the door and
    sustained a minor back injury. The
    patient’s knee wound opened as a
    result of the fall, requiring minor
    suturing. Fortunately, the patient’s

    length of stay did not increase as a
    result of this fall.

    Continuous Quality
    Improvement Model

    After reviewing the data, the team
    developed a multifaceted plan to
    educate unit staff on the safety and
    care of patients with femoral nerve
    block, as well as standardize the
    process for patient care following
    femoral nerve block. The Nerve
    Block Bundle included developing
    and implementing a:
    1. Patient and family education

    sheet to engage patients in their
    care (see Figure 1).

    2. Revised nursing protocol to
    standardize the process for care.

    3. Nursing education plan.
    4. Fall prevention signage specific

    to this population (see Figures 2
    & 3).

    5. Tip sheet for unlicensed assistive
    personnel (UAP) to reinforce the
    care and safety needs of the
    patient with a FNB (see Figure 4).

    The education plan and bundle
    were presented at the NSMC Nursing
    Professional Practice Council, ac –

    cepted into practice, and imple-
    mented August-October 2009.

    Patient/Family Education
    Sheet

    Patient and family education are
    vital in preventing falls (Agency for
    Healthcare Research and Quality,
    2010). The patient/family education
    sheet (see Figure 1) includes informa-
    tion related to pain management,
    duration of the femoral nerve block,
    sensation of the lower extremity,
    and safety guidelines to reinforce the
    patient’s need to call for assistance to
    get out of bed.

    Nursing Protocol
    Sharma and co-authors (2010) rec-

    ommended hospitals develop proto-
    cols addressing decreased quadriceps
    function as a result of a continuous
    FNB. Prolonged nerve blockade can
    last up to 30 hours after termination
    of the continuous femoral nerve
    block (Atkinson, 2008). This study
    recommended the implementation
    of a postoperative evaluation that
    included proprioceptive function.

    FIGURE 1.
    Femoral Nerve Block Patient Information Sheet

    • The femoral nerve block is a regional anesthetic technique used in con-
    junction with general anesthesia for pain relief.

    • It is an effective block that provides both safe and excellent surgical
    anesthesia and postoperative pain control.

    • Your leg will feel numb, but you can still move your leg
    • You will have little or no pain in the front of your leg or knee. However,

    you will probably have some discomfort behind your knee. That is
    expected.

    • Remember to discuss your pain plan with each nurse.
    • REMEMBER: Ring your call bell for assistance.
    • You MUST NOT get out of the bed or chair, or off the commode without

    assistance.
    • Your therapist and/or nurse will instruct you on the safest ways to move.
    • The numbness and weakness from the block usually lasts 8-20 hours

    and occasionally more than 24 hours once it is removed from your
    groin.

    • As the block begins to wear off, you should start your pain medicine that
    was prescribed by the surgeon. REMEMBER: Ask the nurse for your
    pain medication. The nurse will be offering you pain medication, but you
    need to ask as well.

    Thou Shalt Not Fall! Decreasing Falls in the Postoperative Orthopedic Patient with a Femoral Nerve Block

    July-August 2013 • Vol. 22/No. 4248

    Based upon this evidence, a nurs-
    ing protocol was written to include
    the following:
    1. Assess the sensory, motor, and

    vascular condition of the
    extremity every 4 hours during
    and after removal of the femoral
    nerve block until the patient
    obtains full sensation and motor
    function returns.

    2. Maintain fall precautions for the
    duration of the patient stay,
    regardless of assessment of

    FIGURE 2.
    Fem Block Stop Signage

    STOP

    Do Not Get Out of Bed
    Call for Help

    FIGURE 3.
    Fall Prevention Signage

    Fem-Block
    High Risk for Falls!

    Patient:
    Room:
    Date/Time Stopped:

    return of motor function and
    sensory function.

    3. Maintain fall risk signage for the
    duration of the patient stay.

    4. Place signage at the head and
    foot of the bed to reinforce mes-
    saging for the patient, family,
    and staff (see Figures 2 & 3).

    Fall Risk Signage
    Patients typically have the FNB

    removed on postoperative day 2 in

    the early morning. Patients generally
    are discharged on postoperative day
    4 either to home or a rehabilitation
    facility. To im prove patient safety,
    the team decided signage would
    remain for the entire length of stay.

    UAP Education/Tip Sheet
    Based on findings from the litera-

    ture, a one-page educational sheet
    was developed for all UAP (see Figure
    4). The tips were developed by the

    FIGURE 4.
    Safety in Caring for the Patient with a Femoral Nerve Block

    A femoral nerve block is a peripherally inserted catheter that delivers a numbing
    medicine to cover the femoral nerve. A TKR patient usually has the catheter in
    place for 48 hours.

    Structures Seen on Ultrasound in Left Femoral Space
    (viewed from foot)

    The catheter is placed just below the skin surface, next to the femoral nerve. The
    catheter coats the nerve with numbing medicine; this allows for blocking of the
    painful sensations from the hip down the patient’s leg.

    The medicine will numb the patient’s leg. The thigh muscle, or quadriceps, will be
    very weak.

    The leg will be warm, and may be slightly warmer than the non-affected leg.

    The patient will always need two assists when getting out of bed with this catheter
    in place and for a certain period of time after removal.

    Maintain the patient on The Falling Star Program.

    After removal of the femoral nerve block, the same safety precautions will remain
    until the patient has regained complete sensation in the leg. You need to check with
    the nurse before moving the patient to determine if the patient has feeling back in
    his/her leg and identify if the patient can be transferred with one assist.

    Source: Reprinted with permission from Vander Beek, J. (2005).

    Advanced Practice

    July-August 2013 • Vol. 22/No. 4 249

    Atkinson, H.D. (2008). Postoperative fall after
    the use of the 3-in-1 femoral nerve block
    for knee surgery: A report of four cases.
    Journal of Orthopaedic Surgery, 16(3),
    381-384.

    Centers for Medicare and Medicaid Services
    (CMS). (2011). Medicare fact sheet:
    Proposals for improving quality of care
    during inpatient stays in acute care hospi-
    tals in the fiscal year 2011 notice of pro-
    posed rulemaking. Retrieved from http://
    www.cms.gov/Medicare/Medicare-Fee-
    for-Service-Payment/AcuteInpatientPPS/
    downloads/FSQ09_IPLTCH11_NPRM04
    1910.pdf

    Kasibhatia, R.D., & Russon, K. (2009).
    Femoral nerve blocks. Journal of
    Perioperative Practice, 19(2), 65-69.

    Muraskin, S.I., Conrad, B., Zheng, N., Morey,
    T.E., & Enneking, M.D. (2007). Falls
    associated with lower-extremity-nerve
    blocks: A pilot investigation of mecha-
    nisms. Regional Anesthesia and Pain
    Medicine, 32(1), 67-72.

    Rutherford, P., Moen R., & Taylor, J. (2009).
    TCAB: The “how” and the “what.”
    American Journal of Nursing, 109(11), 5-
    17.

    Sharma, S., Iorio, R., Specht, L.M., Davies-
    Lepie, S., & Healy, W.L. (2010). Compli –
    cations of femoral nerve block for total
    knee arthroplasty. Clinical Ortho paedics
    and Related Research, 468(1), 135-140.

    Vander Beek, J. (2005). Finding the femoral
    nerve. Retrieved from http://www.neurax
    iom.com/html/finding_the_femoral.php

    ADDITIONAL READINGS
    Schulz-Stubner, S., Henszel, A., & Hata, J.S.

    (2005). A new rule for femoral nerve
    blocks. Regional Anesthesia and Pain
    Medicine, 30(5), 473-477.

    Turjanica, M.A. (2007). Postoperative continu-
    ous peripheral nerve blockade in the
    lower extremity total joint arthroplasty
    population. MEDSURG Nursing, 16(3),
    151-154.

    FIGURE 5.
    Falls Associated with Femoral Nerve Blocks per Month

    (January 2009 – September 2010)

    TCAB team in collaboration with
    physical therapists. This education
    guide was reviewed with and sup-
    plied to all UAPs, and has been
    incorporated into new hire orienta-
    tion for employees on these units.
    The educational process consisted of
    either 1:1 education or group ses-
    sions. The educator continued to
    contact UAPs individually to vali-
    date understanding of the informa-
    tion provided.

    Nursing Implications
    In the calendar year 2009, Phippen

    6 and 7 had a reported falls rate of 5.2
    per 1,000 patient days. Following
    implementation of the FNB educa-
    tion plan and bundle, the unit fall
    rate decreased to 2.9 per 1,000 patient
    days, with a facility reported rate of
    3.52 per 1,000 patient days (see Figure
    5). The bundle was effective in
    decreasing falls among patients with
    FNB, also contributing to the im –
    proved overall fall rate.

    The team has been able to sustain
    the gains, in large part because of the
    interdisciplinary and multifaceted
    approach to analyzing the issue, pro-
    viding education, and implementing
    necessary practice changes. The sig-
    nage has continued to have a posi-
    tive influence on the fall prevention
    project as it serves as a helpful visual
    reminder for staff, patients, and fam-
    ilies. Education, audits, and re mind –

    ers to keep signs in place are ongo-
    ing. Staff members now utilize the
    two-person assist method with all
    affected patients during the duration
    of the FNB as well as after the block
    is removed, until sensation and
    motor function have returned as
    determined by the nurse. Patients
    are more aware of the need for assis-
    tance now due to the signage and
    education sheet. Patients and fami-
    lies have identified the value of the
    information. All newly hired staff
    members review the bundle during
    the orientation period. Fall data also
    continue to be evaluated.

    Conclusion
    The TCAB approach engaged unit

    leaders, clinicians, and patients to
    improve the quality and safety of
    patient care on two orthopedic-
    neurologic units. There was only one
    recorded fall in patients with FNB
    after implementation of the FNB
    bundle, from September 2009 to
    December 2010. It is amazing what a
    little bit of knowledge and education
    can accomplish!

    REFERENCES
    Agency for Healthcare Research and Quality.

    (2010). The falls management program:
    A quality improvement initiative for nurs-
    ing facilities. Retrieved from http://www.
    ahrq.gov/research/ltc/fallspx/fallspxman
    ual.htm

    Jan
    2009

    Mar
    2009

    May
    2009

    July
    2009

    Sept
    2009

    Nov
    2009

    Jan
    2010

    Mar
    2010

    May
    2010

    July
    2010

    Sept
    2010

    N
    u

    m
    b

    e
    r

    o
    f

    F
    a
    lls

    2.5

    2

    1.5

    1

    0.5

    0

    Date

    Thou Shalt Not Fall! Decreasing Falls in the Postoperative Orthopedic Patient with a Femoral Nerve Block

    Reproduced with permission of the copyright owner. Further reproduction prohibited without
    permission.

    Research

    Topic: Connected vechicles

     Research (Applications, Implementations, Available Guidelines), 

    Conclusions/Recommendations, 

    and References.

    Research

    Topic: Impact of Divorce on Children 

    Assignment #2  2Pg

    Use the topic and answer these questions below: 

    How has the problem been addressed so far? What has been the result? 

    Who are the stakeholders? Are there opposing sides of the issue? 

    Are there marginalized voices that should be included?

    Must answer these questions thoroughly. 

    Focus more on what comes of the children. Data and Statistics 

    RESEARCH

    Sheet1

    0 research question study design sample size and method independent variables and method dependable variables and measures results general strengths general weakness overall summary quality of study
    Azarpazhooh, A., Lawrence, H. P., & Shah, P. S. (2016). Xylitol for preventing acute otitis media in children up to 12 years of age. Cochrane database of systematic reviews, (8). To evaluate the efficacy and safety of xylitol for the prevention of acute myeloid leukemia (AOM) in children ages 12 and under Meta-analysis – no reviews of any type allowed Randomised controlled trials Xylitol acute myeloid Leukemia In the initial systematic search, 1826 articles were found, with potentially eligible articles being retrieved in full text. The network meta – analysis (equivalent to 3 RCTs) with 3405 participants that met the inclusion criteria A natural sweetener called xylitol has been shown to reduce the risk of tooth decay in products such as chewing gum, candy, toothpaste, and prescription medications over time. There were only a few papers included in the meta-analysis, and the vast majority of those studies all came from the same study organization. The administration of xylitol as a preventative measure to healthy children in childcare centers has been shown in studies of moderate quality to minimize the occurrence of AOM. good
    Ferreira, L. A., Grossmann, E., Januzzi, E., Gonçalves, R. T. R. F., Mares, F. A. G., Paula, M. V. Q. D., & Carvalho, A. C. P. (2015). Ear acupuncture therapy for masticatory myofascial and temporomandibular pain: a controlled clinical trial. Evidence-based complementary and alternative medicine, 2015 Is Ear Acupuncture Therapy for Masticatory Myofascial and Temporomandibular Pain, A Controlled Clinical Trial ? – this has nothing to do with ear infections, children, or chewing gum clinical trial 20 patience were randomized to 2 groups of 10 each Ear acupuncture pain sensation In both groups, symptoms of muscle and joint pain decreased statistically significantly with therapy with either of the two well-established therapeutic approaches. Adjunctive therapies like acupuncture can help patients improve their quality of life by reducing chronic symptoms. Small sample size, long-term monitoring, comparison with a placebo control group, and post-treatment evaluation are the key issues that arise. Ear acupuncture adjunct therapy has reduced muscle and joint TMD pain symptoms more quickly and dramatically than solitary occlusal therapy in short-term treatment. fair
    Rai, S., Koirala, K., & Sharma, V. (2013). Role of nasal decongestants in spontaneous healing of traumatic tympanic membrane perforation. Nepalese Journal of ENT Head and Neck Surgery, 5(1), 14-16 To examine the role of nasal decongestants in the healing of tympanic membrane ruptures that result from trauma. – this also has nothing to do with your PICO prospective studies randomized study sample size 58 patientss divided into 2 groups Traumatic Perforation decongestants On average, 51.7% of patients in our series had damage to their left side, while 32.8% of patients had damage to their right ear, and 15.5% of patients had injuries on both sides of their ears. This could be due to the fact that because the majority of people are right-handed and because the left ear was slapped as a result of slapping Oral and nasal decongestants were found to aid in the creation of an environment conducive for the spontaneous repair of traumatic TM perforation in this study. patients’ eustachian tubes often become dysfunctional as a result of the common cold’s rapid and repetitive weather changes in our region. The likelihood of spontaneous healing of traumatic tympanic membrane perforations rises with regular use of nasal decongestants. good
    Ngo, C. C., Massa, H. M., Thornton, R. B., & Cripps, A. W. (2016). Predominant bacteria detected from the middle ear fluid of children experiencing otitis media: a systematic review. PloS one, 11(3), e0150949. Are bacteria found in the middle ear fluid of children with Otitis Media? meta-analysis random sampling, AOM/RAOM microbial etiology ear infection In the initial systematic search, 9617 articles were found, with 888 potentially eligible articles being retrieved in full text. The network meta – analysis includes 66 publications (equivalent to 126 RCTs) with 10483 participants that met the inclusion criteria. Continuous monitoring of OM pathogens using proper detection technologies can aid in the development of better vaccinations to guard against the complex combination of otopathogens found in the middle ear. The pathophysiology of this condition is poorly understood, making it difficult to create effective intervention options. S. pneumoniae, H. influenzae, and M. catarrhalis have remained surprisingly consistent as the leading bacteria causative for OM locally within the middle ear of children over the world for the past 40 years. good
    Marom, T., Marchisio, P., Tamir, S. O., Torretta, S., Gavriel, H., & Esposito, S. (2016). Complementary and alternative medicine treatment options for otitis media: a systematic review. Medicine, 95(6). what are the alternativ medicine treatment of ear infection? prospective studies – this is also a review article Randomized controlled trials sample were children conventory and alternative medicine, medical therapies otitis media Alternative treatments for ear infection include probiotics, vitamin D supplementation, chiropractic, osteopathy, and acupuncture. CAM makes an attempt to provide a customised approach to the sick child, taking into consideration the parents’ previous experiences. The value of complementary and alternative medicine (CAM) therapies in the treatment of Otitis media has not been established. The medical profession no longer considers complementary and alternative medicine (CAM) a legitimate treatment option for OM because of the lack of scientific data backing it. moderate
    hyperkinks
    https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0150949 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0150950
    https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled
    https://www.hindawi.com/journals/ecam/2015/342507/
    https://sci-hub.se/10.3126/njenthns.v5i1.16854
    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4753897/
    PICO Is chewing gum(I) effective in reducing pain(O) in children with ear infection(P) when compared to decongestants(C)
    Database googlescholar.com
    keywords Otitis media, Decongestanta, chewing gum,troumer perferation,ear acupuncture, pain sensation, Xylitol, Acute Myloid Leukemia

    https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0150949
    https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0150949
    https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled
    https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled
    https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled
    https://www.hindawi.com/journals/ecam/2015/342507/
    https://sci-hub.se/10.3126/njenthns.v5i1.16854
    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4753897/

    RESEARCH

    Sheet1

    0 research question study design sample size and method independent variables and method dependable variables and measures results general strengths general weakness overall summary quality of study
    Azarpazhooh, A., Lawrence, H. P., & Shah, P. S. (2016). Xylitol for preventing acute otitis media in children up to 12 years of age. Cochrane database of systematic reviews, (8). To evaluate the efficacy and safety of xylitol for the prevention of acute myeloid leukemia (AOM) in children ages 12 and under Meta-analysis Randomised controlled trials Xylitol acute myeloid Leukemia In the initial systematic search, 1826 articles were found, with potentially eligible articles being retrieved in full text. The network meta – analysis (equivalent to 3 RCTs) with 3405 participants that met the inclusion criteria A natural sweetener called xylitol has been shown to reduce the risk of tooth decay in products such as chewing gum, candy, toothpaste, and prescription medications over time. There were only a few papers included in the meta-analysis, and the vast majority of those studies all came from the same study organization. The administration of xylitol as a preventative measure to healthy children in childcare centers has been shown in studies of moderate quality to minimize the occurrence of AOM. good
    Ferreira, L. A., Grossmann, E., Januzzi, E., Gonçalves, R. T. R. F., Mares, F. A. G., Paula, M. V. Q. D., & Carvalho, A. C. P. (2015). Ear acupuncture therapy for masticatory myofascial and temporomandibular pain: a controlled clinical trial. Evidence-based complementary and alternative medicine, 2015 Is Ear Acupuncture Therapy for Masticatory Myofascial and Temporomandibular Pain, A Controlled Clinical Trial ? clinical trial 20 patience were randomized to 2 groups of 10 each Ear acupuncture pain sensation In both groups, symptoms of muscle and joint pain decreased statistically significantly with therapy with either of the two well-established therapeutic approaches. Adjunctive therapies like acupuncture can help patients improve their quality of life by reducing chronic symptoms. Small sample size, long-term monitoring, comparison with a placebo control group, and post-treatment evaluation are the key issues that arise. Ear acupuncture adjunct therapy has reduced muscle and joint TMD pain symptoms more quickly and dramatically than solitary occlusal therapy in short-term treatment. fair
    Rai, S., Koirala, K., & Sharma, V. (2013). Role of nasal decongestants in spontaneous healing of traumatic tympanic membrane perforation. Nepalese Journal of ENT Head and Neck Surgery, 5(1), 14-16 To examine the role of nasal decongestants in the healing of tympanic membrane ruptures that result from trauma. prospective studies randomized study sample size 58 patientss divided into 2 groups Traumatic Perforation decongestants On average, 51.7% of patients in our series had damage to their left side, while 32.8% of patients had damage to their right ear, and 15.5% of patients had injuries on both sides of their ears. This could be due to the fact that because the majority of people are right-handed and because the left ear was slapped as a result of slapping Oral and nasal decongestants were found to aid in the creation of an environment conducive for the spontaneous repair of traumatic TM perforation in this study. patients’ eustachian tubes often become dysfunctional as a result of the common cold’s rapid and repetitive weather changes in our region. The likelihood of spontaneous healing of traumatic tympanic membrane perforations rises with regular use of nasal decongestants. good
    Ngo, C. C., Massa, H. M., Thornton, R. B., & Cripps, A. W. (2016). Predominant bacteria detected from the middle ear fluid of children experiencing otitis media: a systematic review. PloS one, 11(3), e0150949. Are bacteria found in the middle ear fluid of children with Otitis Media? meta-analysis random sampling, AOM/RAOM microbial etiology ear infection In the initial systematic search, 9617 articles were found, with 888 potentially eligible articles being retrieved in full text. The network meta – analysis includes 66 publications (equivalent to 126 RCTs) with 10483 participants that met the inclusion criteria. Continuous monitoring of OM pathogens using proper detection technologies can aid in the development of better vaccinations to guard against the complex combination of otopathogens found in the middle ear. The pathophysiology of this condition is poorly understood, making it difficult to create effective intervention options. S. pneumoniae, H. influenzae, and M. catarrhalis have remained surprisingly consistent as the leading bacteria causative for OM locally within the middle ear of children over the world for the past 40 years. good
    Marom, T., Marchisio, P., Tamir, S. O., Torretta, S., Gavriel, H., & Esposito, S. (2016). Complementary and alternative medicine treatment options for otitis media: a systematic review. Medicine, 95(6). what are the alternativ medicine treatment of ear infection? prospective studies Randomized controlled trials sample were children conventory and alternative medicine, medical therapies otitis media Alternative treatments for ear infection include probiotics, vitamin D supplementation, chiropractic, osteopathy, and acupuncture. CAM makes an attempt to provide a customised approach to the sick child, taking into consideration the parents’ previous experiences. The value of complementary and alternative medicine (CAM) therapies in the treatment of Otitis media has not been established. The medical profession no longer considers complementary and alternative medicine (CAM) a legitimate treatment option for OM because of the lack of scientific data backing it. moderate
    hyperkinks
    https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0150949 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0150950
    https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled
    https://www.hindawi.com/journals/ecam/2015/342507/
    https://sci-hub.se/10.3126/njenthns.v5i1.16854
    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4753897/
    PICO Is chewing gum(I) effective in reducing pain(O) in children with ear infection(P) when compared to decongestants(C)
    Database googlescholar.com
    keywords Otitis media, Decongestanta, chewing gum,troumer perferation,ear acupuncture, pain sensation, Xylitol, Acute Myloid Leukemia

    https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0150949
    https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0150949
    https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled
    https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled
    https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled
    https://www.hindawi.com/journals/ecam/2015/342507/
    https://sci-hub.se/10.3126/njenthns.v5i1.16854
    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4753897/

    Research

     

    Search for an article written by an author who works within your chosen career field by:

    • Accessing the University Library and searching by subject
    • Using another tool of your choice

     As you review the article you select, consider not only what is written,  but how it is written. Make observations about the writing style and  prepare to share those details with the class. 

     

    Discuss the elements of rhetorical situation by responding to the following in a minimum of 175 words: 

    • Which article did you select?
    • What was the author’s purpose for writing the article? 
    • Who was the author’s target audience?
    • How might you describe the writer’s general tone of voice? 
    • How does this author establish their credibility in this field?
    • Is this a credible source? How can you tell?
    • What other details about how the article was written stood out to you as important?

     Include a reference list at the end of your post that credits the piece you read. Use a citation generator, such as the Reference & Citation Generator  in the Center for Writing Excellence, to cite the article in your  response. Format your in-text citations (e.g., Adams, 2016, p. 23) and  reference list (i.e., list of resources at the end of the document)  using APA format. Consult the References page on the APA Style website for assistance.  

      • 9

      RESEARCH

      2

      PICOT Question:

      A patient of age 40 years is diagnosed with some lung problems and admitted to hospital. How effective will be the strategy of cessation of smoking for the period of two months to overcome the lung problems as compared to chemotherapy and inhalers

      p

      A 40year-old patient diagnosed with lung cancer

      The most common cancer-related cause of death in the United States is malignant lung tumors. As many as 83 percent of lung cancer patients continue to smoke after being diagnosed with the disease, according to a recent study. People with early-stage lung cancer who smoke have an almost twofold increased risk of dying from the condition if they continue to smoke. Cigarette smoking is responsible for as many as 90 percent of all lung cancer cases, according to current estimates. Lung cancer is diagnosed in 24–60% of patients, compared to 12–29% of the general population in the United States. Up to 83% of people with lung cancer who have been diagnosed with smoking after obtaining the diagnosis, continue to smoke. (Cataldo, et al, 2010)

      I

      cessation of smoking

      Preparation, intervention, and maintenance make up the three components of smoking cessation therapy (Stead, et al, 2013). In order to boost both a smoker’s desire to stop and his or her belief in one’s own ability to succeed in their efforts, it is important to take actions to prepare. Intervention can come in a variety of forms to help smokers kick the habit. Long-term sobriety involves the practice of maintenance, which may include encouragement, coping techniques, and the use of behavioral substitutions. Smokers who want to completely quit smoking typically follow the advice of a medical practitioner. Quitting smoking can be made easier with the help of public or private smoking cessation kits, books, recordings, and over-the-counter medications, as well as private smoking cessation packages. An example of how one group might benefit from the assistance of another is the Great American Smoke out and other mass media and community-based campaigns. Many choices are available, including free and commercial clinics, counseling, and more. For the vast majority of smokers, this is the most effective and cost-efficient method for quitting. Quitting smoking can be accomplished in a variety of ways, including on one’s own, with the help of a health professional, or with the aid of a quit-smoking guide. It is possible to effectively quit smoking, but sustaining that status requires assistance from others and additional measures like relapse prevention.

      C

      chemotherapy and inhalers

      (Etter, et al, 2002) explains that, Additional treatments to stop smoking, such as nicotine inhalers and chemotherapy, are also available. Smoking cessation is the most popular technique of stopping smoking, and it is also the most effective. The puffing motion of a nicotine inhaler might cause irritation of the tongue and throat. As well as causing stomach pain and headaches, it can induce coughing. In addition, the cost is considerably high. Cigarette smokers are more likely to experience side effects from chemotherapy and radiation such as infection, weariness, heart and lung difficulties, and weight loss than nonsmokers, according to the American Society for Clinical Oncology (ASCO).

      O

      Outcome of cessation of smoke are immediate benefits such as improved oxygenation and lower blood pressure, improved senses of smell and taste, improved circulation and breathing, greater energy and an improved immune response after quitting smoking. Health advantages include; risk of developing multiple primary lung cancer tumors decreases. (Cataldo, et al, 2010) remaining life expectancy has been lengthened. Patients who quit smoking after being diagnosed with lung cancer have shown to have a considerable improvement in their quality of life. primary lung tumor increased the risk of death by around 20%, but adjusted estimates showed that continuing smoking increased that risk by more than twofold. There are fewer complications following surgery than there are before. Postoperative problems are more common in smokers, whereas nonsmokers are at a lower risk. NSCLC patients who had surgery for sleeve lobotomies were studied for surgical morbidity and mortality. Postoperative complications, including infection and bronchopleural fistula, as well as morbidity and death, were significantly influenced by current smoking in the research participants.

      citation

      Research statement

      Sample size and method

      Results

      limitation

      Final summary

      Cataldo, J. K., Dubey, S., & Prochaska, J. J. (2010). Smoking cessation: an integral part of lung cancer treatment. Oncology78(5-6), 289-301.

      The paper reports on

      the benefits of smoking cessation for lung cancer patients

      Descriptive

      Quantitative analysis

      immediate benefits such as improved oxygenation and lower blood pressure, improved senses of smell and taste.

      Patients have a considerable improvement in their quality of life

      More study is required in order to design smoking cessation strategies that are successful and personalized.

      lung cancer patients who smoke are extremely dependent on tobacco during a life-threatening situation; study is needed to provide effective and targeted smoking cessation therapies for these patients

      Stead, L. F., Buitrago, D., Preciado, N., Sanchez, G., Hartmann‐Boyce, J., & Lancaster, T. (2013). Physician advice for smoking cessation. Cochrane database of systematic reviews, (5).

      To assess the effectiveness of advice from physicians in promoting smoking cessation

      analytical

      Randomized trials

      Preparation, intervention, and maintenance make up the three components of smoking cessation therapy

      Although more intensive therapies have an advantage over very brief interventions, simple guidance has no influence on quitting rates.

      The development of techniques to increase the frequency with which smokers are identified and offered guidance and help presents a significant challenge.

      Etter, J. F., Laszlo, E., Zellweger, J. P., Perrot, C., & Perneger, T. V. (2002). Nicotine replacement to reduce cigarette consumption in smokers who are unwilling to quit: a randomized trial. Journal of clinical psychopharmacology22(5), 487-495.

      To evaluate if nicotine replacement treatment, provided in a real-world setting, could reduce cigarette consumption among smokers who were unwilling to stop.

      analytical

      Randomized trials.

      Sample-20 Cigarette smokers who had no intention of quitting in 6 months

      The puffing motion of a nicotine inhaler might cause irritation of the tongue and throat.

      Cigarette smokers will experience side effects from chemotherapy and radiation such as infection

      A placebo effect was responsible for a large portion of this reduction. Treatment with nicotine to reduce smoking had no negative effects on quitting.

      It is costly to conduct tests for specific markers like anabasine or any of the other non-specific indicators seen in the blood after exposure to smoke from a cigarette.


      References

      Cataldo, J. K., Dubey, S., & Prochaska, J. J. (2010). Smoking cessation: an integral part of lung cancer treatment. Oncology78(5-6), 289-301.


      https://scholar.google.com/scholar?hl=en&as_sdt=0%2C5&q=Smoking+Cessation%3A+An+Integral+Part+of+Lung+Cancer+Treatment&btnG=

      Etter, J. F., Laszlo, E., Zellweger, J. P., Perrot, C., & Perneger, T. V. (2002). Nicotine replacement to reduce cigarette consumption in smokers who are unwilling to quit: a randomized trial. Journal of clinical psychopharmacology22(5), 487-495.

      https://journals.lww.com/psychopharmacology/Abstract/2002/10000/Nicotine_Replacement_to_Reduce_Cigarette.8.aspx

      Stead, L. F., Buitrago, D., Preciado, N., Sanchez, G., Hartmann‐Boyce, J., & Lancaster, T. (2013). Physician advice for smoking cessation. Cochrane database of systematic reviews, (5).

      https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD000165.pub4/full

      Research

       Based on the strength of the evidence from the three articles reviewed in do introduce substance abuse programs compared to no substance abuse programs reduce substance abuse within a year., decide if a practice change or a recommendation for the implementation of a practice is indicated. You will make a recommendation to change or not change current practice (“C”) to the new practice that you reviewed (“I”) based on this evidence. 

      Prepare a voice-over PowerPoint presentation summarizing the PICO question, research findings, recommendations for change/no change to practice, and rationale for the recommendation.  Limit your presentation to no more than 10 minutes and 8-10 slides that are clear, succinct, and compelling enough to convince the audience of the soundness of your recommendation. 

        • 20

        RESEARCH

         Discuss your individual critical analysis of the posted article with in-text referencing to support your thoughts and ideas and with a reference list .

         

        1.      Analyze and discuss why a QI project was needed.

        2.      What initial steps were assessed by the QI team? Discuss their findings, including the data.

        3.      Why was the focus of the QI project on a specific population?

        4.      Analyze the QI model used for this project. Name and discuss an alternative QI model that could have been used in this project.

        5.      Evaluate the findings of the QI project. Were the findings relevant? How did the RNs utilize and integrate the findings into their nursing    practice?

        6.      What is your cosmic question?

        • 15

        Research

        Tentative Title

        An Analysis of the Supreme Court’s Decision in Lukumi Babalu Aye v. Hialeah and How the Case Fits into the Interpretation of the Practice Clause of the First Amendment Freedom of Religion Guarantee

        Topic Description

        Practitioners of the Yoba religion, also known as Santeria, sacrifice animals, including fowls, goats and turtles as part of their rituals, after which the sacrificed animals are consumed as food. Hialeah, Fla., officials adopted an ordinance prohibiting ritual sacrifice of animals within the city limits. The church claimed that the ordinance violated its members’ constitutional freedom of religion rights. The lower courts applied the Smith doctrine, which distinguishes between religious faith and religious conduct, to the Hialeah issue.

        Purpose of Term Paper

        The researcher proposes to explore and analyze literature related to issues raised before the U.S. Supreme Court in Church of the Lukumi Babalu Aye, Inc. v. Hialeah. In the conclusion of the paper, the researcher will attempt to identify rationales the U.S Supreme Court used in its ruling and implications of the outcome.

        Value of the Study

        The researcher will arrive at a clearer understanding of the guarantee of freedom of religion – particularly the difference between belief and an action based upon faith.

        Bibliography of Tentative Sources

        Articles

        “Babalu Aye Is Not Pleased: Majoritarianism and the Erosion of Free Exercise,” 45 U. Miami L. Rev. 1061 LEXIS (May 1991).

        Colson, Charles. “The Cross and the Crown.” Chapter in Kingdoms in Conflict. New York: William Morrow & Company, Inc., 1987, 109-21.

        Lawton, Kim A. “Uncle Sam v. First Church.” Christianity Today, 7 October 1991, 25-28.

        Laycock, Douglas. “Summary and Synthesis: The Crisis in Religious Liberty,” 60 Geo. Wash. L. Rev. 841 LEXIS (March 1992).

        McConnell, Michael W. “Accommodation of Religion: An Update and a Response to the Critics,” 60 Geo. Wash. L. Rev. 685 LEXIS (March 1992).

        Pelieur, Matthew. “Commercial Speech Applications of the Lukumi Case.” Journal of Church and State 21 (Fall 1993): 294-99 in Advertising Law Anthology 17 (1993): 701-25.

        Ward, Antonio. “Santeria Case May Affect First Amendment Rights of Journalists,” American Journalism Review 19 (January 1993): 43-48.

        Cases

        Church of the Lukumi Babalu Aye, Inc. v. Hialeah, 508 U.S. 520 (1993).

        Good News Club et al. v. Milford Central School, 533 U.S. 98 (2001).

        Lyng v. Northwest Indian Cemetery Protective Assn., 485 U.S. 439 (1988).

        Oregon et al. v. Alfred L. Smith et al., 494 U.S. 872, (1990).

        Research

        Post an example of a tool you believe is an excellent patient teaching tool (either a link or as an attachment). Why do you find this tool so effective? Which principles of good teaching-learning does it follow? What principles of teaching and learning do you see that are regularly violated in your practice setting? Which are implemented well?

        Health beliefs and behaviors can affect learning and care. Describe a situation in which you encountered a barrier to care or learning due to health beliefs, behaviors, or attitudes. How did you handle the situation? How might you have done things differently? write this in 500 words APA format. need this in 14hours.

          • 10

          RESEARCH

          Research a research-based article within your local Library or the AHIMA BoK for AHIMA members.  Provide a brief summary of the article findings (250 -300 words) and explain whether the research study relates to basic research or applied research methods.  Page 8 of the Watzlaf and Forrestal book provides a good differentiation between the two types.   If you think your study actually is a combination of both research methods please describe.   There is no right or wrong answer but your 2 -3 sentence explanation must justify what type of research method you have identified.   Provide the reference for your article in APA format, after your summary. 

          The research should be something in epidemiology, we are basically looking for research based article that either uses basic research or applied research. Whatever research based article you choose should relate to either of the two. If the research article you choose is a combination of both, then you also describe.

          It is worth 100 points.

          research

          ENC 1102, 1/31/22

          Prof. Scarpati

          First Research Paper, due Wednesday, March 16, 2022

          St. Thomas University, Miami Gardens, FL

          Research Paper

          Your first research paper, 7 – 10 pages in length with a bibliography and citations (follow the MLA for pagination purposes), will be due Wednesday, March 16, 2022, which is approximately half-way through the semester, given that a semester is 17 weeks in length. Your analysis of the literature studied in class must reach at least seven pages, as the bibliography—titled References—should not be considered when page length is provided. Follow the examples in the MLA style sheet that are presented in the text or access the Modern Language Association’s style sheet on the net or in the stacks in the library, to paginate your secondary sources that bolster and support your thesis statement.

          Process

          This is just a suggestion as writing is an individual thing, but we will cover the process of analyzing literature in class several times by first writing an outline, in order to find major topics for development, to include material to be covered in different paragraphs, and to arrive at a thesis statement. The best way to approach this outline is first to determine the literature that you would like to consider for development. Don’t spend too much time with regard to this assessment; just go with your feelings following a first or second read of the short story of your choice. You may want to include more than one story for development of your thesis statement, but you certainly don’t have to do this. The way that I approach the outline is to randomly write my assessments of what I believe to be major areas for development by the author. You can include specific parts of the story for inclusion in these major areas, or you may want to include these areas in a separate process where notes on the primary story take place. Either way the idea is to present a major idea for development in a topic sentence with specific details concerning information presented by the author in the story included to round out the examples you present in your paragraphs. That is the essence of good writing, broad general ideas presented in your topic sentences with four to six sentences provided as examples supporting these topic sentences in the rest of the paragraph. Focus on the thesis statement should be your number one concern. Consider utilizing transitions leading your reader from one sentence to the following one and from one paragraph to the next.

          References

          It is not imperative to research many secondary sources to bolster your thesis. But it is wise to take notes based on your secondary research of outside sources and how these writers analyze the story under consideration and how these assessments apply to your thesis statement. Instead of quoting directly from these sources, it is suggested you provide your assessments of these writers’ analysis, by incorporating a synthesis of assessing why their words make sense to support your thesis. Using wording such as “According to” when introducing outside secondary sources and then naming the author’s last name and then proceeding with your take on why the information makes sense in the course of your development of the thesis is highly suggested. When you use direct quotes, the effect is jarring because the professional writer will certainly have a greater grasp of the language than you do. Also, using many direct quotes leads me to believe that you are desperate to reach the minimum length. Just believe in your own assessments and analysis of the literature, and you will most likely be in better shape than to place too much emphasis on published assessments of the literature.

          Proofing

          Give yourself a couple of days before finalizing the editing of your work. The best scenario is to finish the paper and then return to it in a day or two, to begin the proofreading process. Pay attention to grammar and the notion of providing variety with respect to sentence structure throughout your essay. Subject-verb agreement should also be strongly considered, as should run-on constructions (avoid) and fragments (also avoid).

          Research

          1



          Evidence-Based Practice Project Paper


          Objective:

          1. Explain the role of nursing research within clinical practice.


          Topic:

          Overview

          In this assignment, you will describe a patient problem that you see or have seen in practice. You will then identify, revise, or develop a policy, protocol, algorithm, or standardized guideline to be used in your practice site that is based on current research evidence. You are proposing the implementation of an intervention that is supported by research; thus you are proposing an evidence-based practice (EBP) project. You are not proposing a

          study to be conducted in your agency.

          Your final paper should be no more than 5 pages, which does not include the protocol, policy, or algorithm, and references for your project. This assignment is worth 100 points.

          Ideas for Selection of an Evidence-Based Intervention for Practice

          Describe a patient problem that is relevant to your practice. It can be any patient care problem or issue that is of interest to you in your current practice or for your future role as an administrator. Find an intervention that is considered effective based on research to manage this problem. Important clinical areas that have been researched include the following:

          · Fall prevention or management

          · Prevention of pressure ulcers

          · IV and/or arterial line management

          · Infection control problems—select a specific situation

          · Pain identification, documentation, and/or management

          · Visitation in ICUs

          · Family involvement intervention based on research

          · Nurse Retention intervention

          · Alternative staffing process

          · Safety—pick a specific situation and implement a research-based intervention to manage it.

          · Shift of care from hospital to home and/or ambulatory care centers

          · Nursing leadership—effective leadership behavior that is research based

          · Communication of shift report in specialized way based on research

          · Provision of specific aspect of care (research-based intervention) to patients with illness such as hypertension, diabetes, congestive heart failure, chronic obstructive lung disease, asthma, obesity, renal problems, gastrointestinal problems, or mental health problems.

          Include the following in your paper:

          · Introduction—provide a brief introduction of your paper including a purpose statement at the end of the introduction (one paragraph)

          · Summarize your project topic—include a summary of the patient problem project you chose and the rationale for choosing it; provide support for choosing your topic from the healthcare literature showing that this is a patient problem (2-3 paragraphs)

          · Literature review—include relevant scholarly, peer-reviewed articles that discuss your patient problem and the proposed intervention. Summarize what is known and not know about the problem selected. At least 3-5 articles should be included in your literature review. (3-5 paragraphs)

          · Proposed Change—Discuss your revision/identification/development of a policy/protocol/algorithm/standardized guideline to be used in your practice site; analyze how it will be implemented and potential affected parties. (provide a copy as an appendix to your paper with any relevant references included) If you are revising a current policy/protocol, please include the original, as well. (3-5 paragraphs)

          · Conclusion—Summarize your paper including your patient problem and proposed change; do not introduce new information here, simply synthesis the information you provided in your paper.

          Research

          Case study source: 

           The Sidney Opera House construction: A case of project management failure (eoi.es) 

           The Sydney Opera House is one of the best-known iconic buildings, recognized around the  world as a global symbol of Australia. The Danish architect Jørn Utzon won the architecture  competition set out by the New South Wales government for the new building in 1957, and the  construction started in 1959. The project was originally scheduled for four years, with a budget  of AUS $7 million. It ended up taking 14 years to be completed and cost AUS $102 million. The  Sydney Opera House could probably be seen as one of the most disastrous construction projects  in history not only from the financial point of view but also for the whole management plan. Lets  analyze the main reasons that led to it.  First of all, at the beginning of any project goals and objectives have to be clearly defined by the  client to provide a guideline for what the project must complete. There are three main factors:  time, cost, and quality. In the case of the Sydney Opera House the last one was the most  important, as it was an almost unrestricted goal of the project and the reason why it was  launched. No indications regarding time or cost limits were either provided for the competition.  Thus, the architects were allowed total freedom in their designs. After Utzon was selected, he presented his “Red Book” in March 1958, which consisted of the  Sydney National Opera House report. It comprised some indications such as plans, sections,  reports by consultants, etc. The funds came almost entirely from a dedicated lottery, so the  project was not a financial burden for the government. Regarding time planning the goal was to  complete the construction at the end of 1962 and have the grand opening at the start of 1963. The  project should have lasted four years. The main stakeholder was the architect, but Utzon was  much more concerned with the design aspect rather than time and costs objectives, which proved  problematic. During the project, Utzon collaborated with Ove Arup, who was in charge of the  structure and the engineering. With some other subcontractors, the team was in charge of  mechanics, electrics, heating and ventilating, lighting and acoustics. There was no real project  manager, but rather collaboration between Utzon and Arup. The other main stakeholder was the client, the state of New South Wales. This encompassed the  Australian government, which launched the competition for the project, and especially the Labor  Premier, Joe Cahill. A part-time executive committee was created to provide project supervision  but the members had no real technical skills. The government eventually became an obstacle to  the project team by inhibiting changes during the progress of the operations and thus contributed  to cost overrun and delays. Finally, the public was an indirect stakeholder because they were  concerned with the projects success. There appeared to be problems from the start of the project that was divided into three stages:  Stage 1 was the podium, stage 2 was the outer shells, and stage 3 was the interiors and windows.  Apparently Utzon protested that he had not completed the designs for the structure, but the  government insisted the construction had to get underway. In addition, the client changed the  requirements of the design after the construction was started, moving from two theatres to four,  so plans and designs had to be modified during construction. Regarding the project’s budget the initial estimation was drawn on incomplete design drawings  and site surveys which later lead to disagreements. The contractors for the first stage successfully  claimed additional costs of AUS $1,2 million in 1962 due to design changes. When it was  completed in 1963, it had cost an estimated AUS $5.2 million and it was already 47 weeks over  schedule for the whole project. Stage two became the most controversial stage of the entire construction. As costs were rising a  new government stepped in and monitored all payments being requested by the Opera House. By  the end of stage one, Utzon submitted an updated estimate of the projects total cost as AUS$12.5  million. As more payments were being delivered and no visible progress was seen, the  government began withholding payments to Utzon. Stage two slowed down and in 1966 Utzon  felt he was forced to resign from the project as his creative freedom was restricted, and therefore  could not bring his perfect idea to fruition. The project was then taken over by three Australian engineers, and stage two was completed in  1967 with a total cost of AUS$13.2 million. When Utzon walked out of the project, he did not  leave any designs or sketches to work with as he was convinced that he would be called back to  the project once the new team failed. This was not so, and due to the lack of designs to work  with, new ones had to be created based on the current structure of the Opera House and many  unforeseen complications were found. Evidently this caused a huge increase in the estimate of  the total cost of the project, which came to AUS$85 million. This came as a shock and nearly an  insult to Utzon who had been fending off the Government from rising costs for years. The news  that they had agreed to that budget, which was more than four times Utzon’s original estimate,  was evidence that he had been unjustly treated. Apparently, there were a lot of delays and cost overruns. The original cost was to be 7 million  dollars and its construction was supposed to be completed by 26 January 1963. But this was only  on paper. The reality was quite different. The Sydney Opera House ended up costing 102 million  dollars and was completed in 1973. Many experts in project management say its construction is  an example of poor or bad project management. But should we always measure the success of a  project by the triple constraints of cost, schedule and quality? Utzon was losing control of the situation and had an undesirable pressure under him. The initial  cost was (Aus) 7 million dollars and in the end it has cost (Aus) 102 million dollars and a total of  14 years to be constructed, 6 more than it should be*. The Arup, engineers contracted for the  engineering part stayed until the end of the project but Utzon left in the end , after designing the  roof but not concluding. During the project, Utzon collaborated with Ove Arup, who was in  charge of the structure and the engineering while subcontractors were in charge of mechanics,  electrics, heating and ventilating, lighting and acoustics. There was no real project manager, but  rather collaboration between Utzon and Arup. When the construction started there was no clear  concept of how the roof might be constructed. It’s not that the estimates were wrong; it’s that  there was nothing to base the estimates on in the first place. Much of the delay and cost overrun  was caused by iteration on roof design and lack of Data, eventually landing on a solution that  constructed the roof out of interlocking tiles, but this solution was only discovered after a lot of  time and effort The other main stakeholder was the client, the state of New South Wales (Australian  government). A executive committee was created to provide project supervision but the members  had no real technical skills. It was hard to keep two of the key stakeholders happy, the minister  David Hughes and the SOHEC – Sydney Opera House Executive Committee so he decided to  quit blaming the first of lack of cooperation but in fact even the acoustic consultants did not  agree between each other and as a result of all these changes of plans and misunderstandings the  Sydney Opera House – finished by three local architects – still did not had the proper acoustic,  which was the first main factor that lead to a new opera house*. Nowadays the Sydney Opera House is already seen as profitable since its cost was already  covered by the revenue made from customers (tourists mainly) but further improvements on  accessing conditions were taken. Stakeholders Before going back to the subject it is needed to  take into account that a failed project is a project that is cancelled before completion, never  implemented, or damaged in some way. Other reasons that why projects fail are an absence of  commitment, a bad project organisation and planning, a bad time management, lack of managerial control, extra costs among other problems. Queen Elizabeth II inaugurated the  Sydney Opera House in 1973, after 17 years of redesigns, underestimates and cost overruns. By  1975, the building had paid for itself, thanks mainly to the lottery system that was created to help  its funding. Utzon was never to return to Australia, never to see the final result of his work that  was recognized as an incredible feat of architecture. In 2003 the architect was honoured with the  Pritzker Prize for architecture, the most renowned architectural prize in the world. 

          To Do- format using proper citation, headings  and structure 

          1- Explain the consequences of underestimating the initial planning in this project and ways to address this problem 

           2- Recommendation on what you would have done differently.

            • 2 months ago
            • 5

            Research

            Evidence Based Practice Project Paper

            Evidence Based Practice Project Paper


            Criteria

            Ratings

            Pts

            This criterion is linked to a Learning OutcomeIntroduction/Conclusion

            30 pts

            Level 5

            Grabs the reader’s attention; provides a complete and concise introduction/conclusion to the paper; a purpose statement relevant to the paper is included.

            27 pts

            Level 4

            Interesting & might get the reader’s attention; provides a complete introduction/conclusion; purpose statement is included, but is vaguely worded.

            24 pts

            Level 3

            Relevant but does not engage the reader’s attention; provides an introduction/conclusion, but it is incomplete, lengthy, or too short; purpose statement is included, but is vaguely worded.

            21 pts

            Level 2

            Relevant but does not engage the reader’s attention; provides an introduction/conclusion, but it is incomplete, lengthy, and/or too short; purpose statement not included

            18 pts

            Level 1

            Dull or trite introduction/conclusion; incomplete or rambling; no purpose statement included.

            0 pts

            Level 0

            No paper was submitted.

            30 pts

            This criterion is linked to a Learning OutcomeProject Summary

            NM465-CO4

            30 pts

            Level 5

            Includes a summary of the patient problem project chosen and the rationale for choosing it; support is provided for chosen topic from the healthcare literature showing that this is a patient problem; the summary is well-developed and provides sufficient detail.

            27 pts

            Level 4

            Includes a summary of the patient problem project chosen and the rationale for choosing it; support is provided for chosen topic from the healthcare literature showing that this is a patient problem; the summary is developed, but lacks depth.

            24 pts

            Level 3

            Includes a summary of the patient problem project chosen; rationale included, but not well-defined; the topic was not supported by literature as a patient problem; the summary is partially developed.

            21 pts

            Level 2

            Includes an incomplete summary of the patient problem project chosen; rationale, if included, was not well-defined or supported by literature.

            18 pts

            Level 1

            The summary did not discuss the patient problem; no rationale included; rambling or incoherent ideas.

            0 pts

            Level 0

            No paper was submitted.

            30 pts

            This criterion is linked to a Learning OutcomeLiterature Review

            NM465-CO4

            30 pts

            Level 5

            3-5 relevant, scholarly, peer-reviewed articles related to patient problem/proposed intervention are synthesized; Summary of what is known/not known about the problem is included.

            27 pts

            Level 4

            3-5 relevant, scholarly, peer-reviewed articles related to patient problem/proposed intervention are included, but findings are not synthesized; Summary of what is known/not known about the problem is included.

            24 pts

            Level 3

            3-5 articles related to patient problem/proposed intervention are included, but they are either not relevant, not scholarly, or not peer-reviewed; Summary of what is known/not known about the problem is included.

            21 pts

            Level 2

            Less than 3 articles included OR articles included are not related to the chosen topic; Summary of what is known/not known about the problem is not included.

            18 pts

            Level 1

            Less than 3 articles included; no summary of what is known/not known about the problem not included; rambling or incoherent ideas.

            0 pts

            Level 0

            No paper was submitted.

            30 pts

            This criterion is linked to a Learning OutcomeProposed Change

            NM465-CO4

            30 pts

            Level 5

            The proposed change is discussed in sufficient detail; analysis of implementation is well-developed; potential affected parties are discussed.

            27 pts

            Level 4

            The proposed change is discussed; analysis of implementation is somewhat developed; potential affected parties are discussed.

            24 pts

            Level 3

            The proposed change is discussed, but lacks details; analysis of implementation is partially developed; potential affected parties are identified.

            21 pts

            Level 2

            The proposed change is not discussed sufficiently; analysis of implementation is poorly developed; potential affected parties are identified.

            18 pts

            Level 1

            The proposed change is not discussed in a coherent manner; analysis of implementation is not included; potential affected parties are not identified.

            0 pts

            Level 0

            No paper was submitted.

            30 pts

            This criterion is linked to a Learning OutcomeGrammar/APA

            PRICE-I

            30 pts

            Level 5

            Mostly free of grammatical and spelling errors. APA format was used correctly. Thoughts flow cohesively throughout the paper.

            27 pts

            Level 4

            Minimal grammatical and spelling errors. APA format was followed with minimal mistakes. Thoughts flow cohesively throughout the paper.

            24 pts

            Level 3

            Moderate amounts of grammatical and spelling errors. APA format was followed but inconsistently; paper does not flow and does not tie the information together.

            21 pts

            Level 2

            Major grammatical and spelling errors. APA was used incorrectly. Paper does not flow and does not tie the information together.

            18 pts

            Level 1

            An unacceptable number of spelling, and grammar. APA format was not followed. Rambling or incoherent ideas throughout the paper.

            0 pts

            Level 0

            No paper was submitted.

            30 pts

            Total Points: 150


            Previous


            Next

            Research

            Running head: Biofilm 2

            Running head: Biofilm 2

            Biofilm-Annotated bibliography

            Institution:

            Student’s name:

            Date:

            Introduction

            The peer-review articles used give specific details on the definition of biofilms and factors considered in effective treatment of biofilms. Cells adhere to one another and, in some cases, to a surface, allowing biofilms to grow and spread. Extracellular polymeric substances bind these adherent cells together in this extracellular matrix. Biofilms can be found on both living and nonliving surfaces (Li et al, 2018). In attaining the purpose of the goal, the annotated bibliography provides data that answers the research question.

            Research Question

            What is biofilm and how is it treated?


            Muhammad, M. H., Idris, A. L., Fan, X., Guo, Y., Yu, Y., Jin, X., … & Huang, T. (2020). Beyond risk: bacterial biofilms and their regulating approaches. Frontiers in microbiology11, 928.

            This article defines biofilm based on the constituents that form the biofilms. Based on the review, bacterial biofilms are formed when secreted proteins and extracellular DNA bind to form dense, surface-attached communities. The growth of a bacterial biofilm can be divided into five distinct stages. The first stage is the reversible attachment phase, in which bacteria attach to surfaces in an unspecific manner. The second stage is the irreversible attachment phase, in which bacteria use adhesins to interact with a surface, synthesizing and releasing signaling molecules to detect one another’s presence, resulting in the formation of a microcolony. Healthcare, food production, and the oceans’ ecosystems health are all threatened by biofilms found in drinking water supply. Thus, biofilm control and prevention have become the focus of current studies. This paper provides a thorough introduction to biofilm development. A range of methodologies and approaches are used to tamper with bacterial adhesion and biofilm matrixes in an effort to remove harmful microorganisms from host environments. Plant protection, biotransformation, and wastewater treatment are just a few of the many uses for biofilms. Adhesion surfaces, QS, and environmental factors can all be manipulated to encourage beneficial biofilm growth.

            Hartmann, R., Singh, P. K., Pearce, P., Mok, R., Song, B., Díaz-Pascual, F., … & Drescher, K. (2019). Emergence of three-dimensional order and structure in growing biofilms. Nature physics15(3), 251-256.

            The review provides a comprehensive definition of biofilms based on the place of existence. According to the review, biological life forms known as biofilms are most common type of life on Earth and are self-replicating in crystals. The properties of conventional liquid crystals and granular particles are determined by the interaction possibilities between the molecules in the system. In growth-active biofilms, it’s not clear if potential-based descriptions can explain the observed morphologies, and which potentials are most relevant. Cell–cell interaction potential can be used to predict Vibrio cholerae biofilm development, emergent architecture, and local liquid–crystalline order at the microscopic scale. Biofilms’ microscopic creation and three-dimensional morphology are also shown to be affected by external fluid flow. It’s possible that in these active bacterial communities, mechanical cell–cell interactions, which can be controlled by modulating the production of different matrix components, may be the source of local cell membrane order and global biofilm architecture.” These findings focus on providing scientific evidence for improved spectrum theories of active matter, which are critical for controlling biofilm growth.

            Thi, M. T. T., Wibowo, D., & Rehm, B. H. (2020). Pseudomonas aeruginosa biofilms. International Journal of Molecular Sciences21(22), 8671.

            Biofilms are the subject of this article, which explains the characteristics and origins of a specific biofilm. Pseudomonas aeruginosa, a bacterium that causes both acute and chronic infections in people with compromised immune systems, is known as an opportunistic human pathogen. Its infamous persistence in clinical settings is largely due to its propensity to form antibiotic-resistant biofilms. One of the most important functions of biofilm is to protect bacteria from the stresses of their environment by providing them with an extracellular scaffold of autogenic polymeric substances. Bacteria can colonize and persist on surfaces for longer when biofilm prevents phagocytosis. Biofilms of P. aeruginosa, including their development stages and molecular mechanisms of invasion and persistence conferred by biofilms, are reviewed throughout the research article. There are interspecies biofilms of P. aeruginosa and common streptococcus that inhibit the virulence of P. aeruginosa and may even improve disease conditions that are produced by the lysis of cells within the bacterial biofilm.

            Otto, M. (2018). Staphylococcal biofilms. Microbiology spectrum6(4), 6-4.

            There are different types of biofilms with each having distinct characteristics such as place of existence and survival. This peer-reviewed journal article investigates Staph biofilm development and its role in human health. There is also a summary of current strategies for the development of anti-biofilm therapies. Staphylococci, particularly Staphylococcus aureus and Staphylococcus epidermidis, are the most common cause of indwelling medical device infections. During device-associated infection, the bacteria’s biofilm phenotype facilitates increased resistance to antibiotics and host immune defenses. Biofilms have grown in popularity in recent years as a medium for the growth of microorganisms. It has also been discovered that biofilm-associated primary infections progress or originate in a wide range of human infections, and this is not an isolated phenomenon. In terms of biofilm research, Staphylococci are second only to Pseudomonas aeruginosa. Because Staphylococci are common human skin colonizers, they are the most common cause of biofilm infections on surgically implanted indwelling medical devices. PJIs and other potentially fatal conditions, such as endocarditis and sepsis, are among the most severe of these infections.

            Zhu, Y., Li, C., Cui, H., & Lin, L. (2020). Feasibility of cold plasma for the control of biofilms in food industry. Trends in Food Science & Technology99, 142-151.

            This review explores into the use of cold plasma for anti-biofilm treatment of products that are manufactured as food within the industry. Biofilms may be able to control cold plasma technology through a variety of mechanisms. Cold plasma’s efficacy against biofilms is also examined in detail in the final chapter, as is the method’s final evaluation as a novel anti-biofilm’s method. Most significant threat to food standards today is biofilm infection, which is a fact that cannot be denied. Due to the biofilm architecture, biofilm microorganisms are more resilient to antibacterial treatment than planktonic microorganisms. By using cold plasma, a new non-thermal processing method, biofilms on food and food-contact materials can be effectively removed from their surfaces. The effectiveness of cold plasma diagnosis in removing biofilms has sparked a new wave of interest in this topic in recent years.

            Li, C., Cornel, E. J., & Du, J. (2021). Advances and Prospects of Polymeric Particles for the Treatment of Bacterial Biofilms. ACS Applied Polymer Materials3(5), 2218-2232.

            This review focuses on polymeric nanoparticles for the treatment of bacterial biofilms, with the goal of summarizing their preparation, mechanism, and recent advances. The researchers begin by investigating the physiological aspects of the bacterial biofilm. A list of physiological factors in biofilms, such as pH, enzymes, reactive oxygen species, hypoxia, and others, can be found here. Following this section, the antibiofilm therapeutic properties of polymer micelles, polymersomes, dendrimers, nanogels, and other polymeric nanoparticles will be discussed in great detail. Polymeric nanoparticles’ toxicity is also examined. Antibiofilm step approach on polymeric nanoparticles face both current and future challenges. Bacterial biofilms are receiving more attention than ever before from antibacterial researchers. A significant challenge remains in treating bacterial biofilms despite advances of antimicrobial agents, including antibiotics. This is due to the fact that bacterial biofilms avert the diffusion and accumulation of antimicrobials. It is possible to enter bacteria biofilms and alter the chemical properties of their microenvironment, allowing polymeric nanoparticles to engage with bacteria or discharge drugs that have been preloaded, due to their specific size and structure.” Polymeric nanoparticles with antibiofilm properties are being developed, and this bodes well for future antibiofilm therapeutics.

            Barzegari, A., Kheyrolahzadeh, K., Khatibi, S. M. H., Sharifi, S., Memar, M. Y., & Vahed, S. Z. (2020). The battle of probiotics and their derivatives against biofilms. Infection and Drug Resistance13, 659.

            Chronic infections, device-related diseases, and medical device malfunction are all examples of biofilm-related infections that have become a significant clinical issue. They are a global health threat because they are inaccessible by the immune system and antibiotics. Getting rid of biofilms by interfering with their adhesion as well as maturation has been found to be an effective strategy. Using probiotics and their derivatives to combat pathogenic biofilms has become increasingly popular in recent years. Probiotics are the subject of this review because they can help prevent bacterial biofilms from forming and maturing. Approximately 65% to 80% of microbial and chronic infections are caused by biofilms, according to the National Institutes of Health (NIH). Microbial biofilms that form on implanted devices (such as aortic valve, catheters, and joint replacements) increase the risk of infection for patients in the hospital. The use of probiotics and their derivative products in the treatment of biofilm infections could benefit from further research.

            Wu, Y. K., Cheng, N. C., & Cheng, C. M. (2019). Biofilms in chronic wounds: pathogenesis and diagnosis. Trends in biotechnology37(5), 505-517.

            Treatment of biofilms requires a comprehensive understanding of the functionality of biofilms in a given set up. According to the review, biofilms have been shown to have a crucial function in the progression of chronic wound infections. It is a long time before chronic wound biofilms can be accurately diagnosed, despite advances in understanding of the underlying mechanism. As well as providing an overview of current diagnostic approaches based on morphological features, microbiology, and molecular assays for chronic wound biofilms, this review will discuss the mechanism by which biofilm formation takes place. There is still an unmet clinical need for wound blotting and transcriptomic analysis, for example. Wound healing has been slowed because of biofilms, which have recently gotten more attention. Multi-pronged strategies are employed in biofilm-based wound care in order to remove biofilms first from wound bed and to maintain epithelial integrity in the wound. Biofilms on wound surfaces cannot be accurately identified by current pre – clinical and clinical diagnostic techniques, making timely medical and surgical intervention impossible. Point-of-care biofilm discovery in chronic wound care will benefit greatly from the on-going development of these advanced laboratory approaches.

            Magana, M., Sereti, C., Ioannidis, A., Mitchell, C. A., Ball, A. R., Magiorkinis, E., … & Tegos, G. P. (2018). Options and limitations in clinical investigation of bacterial biofilms. Clinical Microbiology Reviews31(3), e00084-16.

            This review article summarizes the methodological landscape of biofilm analysis, with an assessment of current trends in methodological research reflected in the findings. Such findings form a basis for treatment of biofilms. Only 5percent of the total of the biofilm literature is focused to methodology, according to a keyword-focused bibliographic search conducted by the researchers. Depending on the composition of the microbial community and the microenvironment, bacteria can form single-species or multispecies biofilms. Within an extracellular matrix that they have constructed, bacteria or viruses exist side by side in complex and multifaceted communities known as biofilms (ECM). Due to the beauty and sophistication of these multicellular communities, along with their role in infectious diseases, biofilm development has received much attention in the last two decades. On nearly any surface, biofilms can form, and they can be either beneficial or harmful, depending on the community’s interactions with the surface and other living things. Comprehensive searches of literature yielded a new understanding of biofilm structure and function and the role they play in disease and host-pathogen interaction.

            Chen, Z., Wang, Z., Ren, J., & Qu, X. (2018). Enzyme mimicry for combating bacteria and biofilms. Accounts of Chemical Research51(3), 789-799.

            Biofilms can be treated through a variety of ways as investigated and supported through research. As a global health issue, bacterial infection is on the rise and antibiotics are the most widely accepted treatment paradigms. Increased antibiotic resistance has resulted from overuse and misuse of antibiotics, making treatment less effective and resulting in higher mortality rates. Bacterial biofilm formation on living and nonliving surfaces makes it even more difficult to combat bacteria because the extracellular matrix can act as a strong barrier to prevent antibiotic penetration and resist environmental stress. This makes it even more difficult to combat bacteria. Because bacteria and biofilms can’t be completely eliminated, they can lead to implant failure, device damage, and persistent infection. To avoid the development of bacterial resistance, it is critical to develop new antimicrobial agents. The creation of artificial enzymes that mimic the functions of natural enzymes will open up new avenues for combating bacteria. In addition, artificial enzymes are more stable, more easily tunable, and can be produced in large quantities for practical use than natural enzymes. Therefore, this can be a viable way to treat biofilms.

            References

            Barzegari, A., Kheyrolahzadeh, K., Khatibi, S. M. H., Sharifi, S., Memar, M. Y., & Vahed, S. Z. (2020). The battle of probiotics and their derivatives against biofilms. Infection and Drug Resistance13, 659.

            Hartmann, R., Singh, P. K., Pearce, P., Mok, R., Song, B., Díaz-Pascual, F., … & Drescher, K. (2019). Emergence of three-dimensional order and structure in growing biofilms. Nature physics15(3), 251-256.

            Li, C., Cornel, E. J., & Du, J. (2021). Advances and Prospects of Polymeric Particles for the Treatment of Bacterial Biofilms. ACS Applied Polymer Materials3(5), 2218-2232.

            Magana, M., Sereti, C., Ioannidis, A., Mitchell, C. A., Ball, A. R., Magiorkinis, E., … & Tegos, G. P. (2018). Options and limitations in clinical investigation of bacterial biofilms. Clinical Microbiology Reviews31(3), e00084-16.

            Muhammad, M. H., Idris, A. L., Fan, X., Guo, Y., Yu, Y., Jin, X., … & Huang, T. (2020). Beyond risk: bacterial biofilms and their regulating approaches. Frontiers in microbiology11, 928.

            Otto, M. (2018). Staphylococcal biofilms. Microbiology spectrum6(4), 6-4.

            Thi, M. T. T., Wibowo, D., & Rehm, B. H. (2020). Pseudomonas aeruginosa biofilms. International Journal of Molecular Sciences21(22), 8671.

            Wu, Y. K., Cheng, N. C., & Cheng, C. M. (2019). Biofilms in chronic wounds: pathogenesis and diagnosis. Trends in biotechnology37(5), 505-517.

            Zhu, Y., Li, C., Cui, H., & Lin, L. (2020). Feasibility of cold plasma for the control of biofilms in food industry. Trends in Food Science & Technology99, 142-151.

            Research

            Read the article titled: “Social Capital and Health Care Experiences among Low-Income Individuals” (attached in the Articles section). Critique the study’s sampling design by answering the attached questions (make sure not to answer with a yes/no; elaborate on each answer by describing what the authors did). Please use the attached word document template to add your answers to.

            Research

             Scenario:  

            Testing the Solution: Training and education:  Employees need to be educated on how to protect customers’ information.  

            1. As a team, determine how you will present insights from your research plan and your test results.
            2. Analyze your Strategic Integration Plan for any weaknesses: Does it provide the solution(s) needed? Make recommendations for improving the solutions(s) within the plan to better address a broader context of your emerging technology problem.
            3. Present the results of your test as organized information. Provide a brief summary of the action steps needed to strengthen your solution. Clearly indicate team members’ contributions.

            Two industries: Telecom and Finance

            Now that your team has crafted a Strategic Integration Plan, it’s time to test your solution. To examine your solution’s potential beyond a specific industry, your team will create a research plan that prepares you to test your solution by considering its usefulness beyond the original context you were given.

            When you chose your team problem at the beginning of this course, you were provided with a hypothetical organization to use as context for solving the problem. However, not all organizations you will work for in the future will narrowly fit into one organization or industry. Work through the following steps to draft your research plan.

            1. Identify two other industries or types of business likely to be affected by your team’s problem. Support your choices with research (cited in APA format).
            2. What strengths and weaknesses does a broader context provide to your proposed Strategic Integration Plan?
            3. Does context dramatically alter your overall strategy or detailed implementation plan?

            Research

            In this research on cancer add diagnostic testing used to confirm the diagnosis, enhance treatment options, or monitor prognosis. Must include lab tests including normal and out-of-range results that confirm or rule out the diagnosis, including blood gases. Please include the progression of those results— for example if the patient has high potassium and kayexalate is ordered and given what would you expect the potassium result to do? Also, use any x-ray and other imaging tests. Write in APA format 7 edition. 2 pages .Need this in 18 hours.

            Research

            1

            EDITORIAL

            Articulating Your Philosophy of Nursing

            As the profession of nursing is dealing with rapid
            changes in knowledge and practice, the specialty of
            school nursing is attempting to articulate its value in
            the educational setting. Both the profession and spe-
            cialty are maturing, and along with this natural pro-
            cess, nurses are clarifying their roles and scope of prac-
            tice. As nurses examine their practice, they also are
            questioning what is fundamentally important to them
            as nurses and as individuals-their values and beliefs.
            This has become particularly critical as more and more
            nurses in all settings are finding that changing de-
            mands and expectations of the role are greater than
            the resources or number of hours in the day to accom-
            plish what nurses would define as quality nursing
            care. Such demands are pushing nurses to examine
            their values and what drew them to the profession of
            nursing in search of balance and meaning in the work
            setting.
            One strategy nurses can use to affirm that their

            practice is in harmony with their value system is to
            write a personal philosophy statement. This might be
            general in nature, such as a philosophy that relates to
            life values; it could be a philosophy statement related
            to beliefs about the profession of nursing; or it might
            be a philosophy specific to school nursing. In each
            case, this activity will encourage nurses to clarify their
            values and then examine how their philosophy fits
            with their professional practice. Articulating a philos-
            ophy statement is an intellectual activity that requires
            careful thought, because values need to be identified,
            clarified, and prioritized. Once these values are iden-
            tified, putting them together into a short, cohesive
            statement is a challenging process (Chitty, 2001).

            The first part of the process is identifying general
            values-values related to the nature of humankind
            and society. These are the core values held by an in-
            dividual, which are few in number but may evolve as
            individuals mature and society changes. Examples of
            these core values may relate to the dignity of man, the
            sanctity of life, or values that give direction to our
            journey of life. Personal values are influenced by fam-
            ily, culture, religious orientation, education, and the
            choice of one’s life work. All of these factors contrib-
            ute to who we are, what we believe, and more impor-
            tantly, how we act.

            Next, values that relate to the profession of nursing
            are delineated. Ideas may come from the American
            Nurses’ Association’s code for nurses (American Nurs-
            es’ Association, 1985) or the Standards o f Professional
            School Nursing Practice (National Association of School
            Nurses, 1998) and may include such themes as caring,
            confidentiality, integrity, accountability, competence,
            and improving the quality of care. Other important
            values of the nursing profession are altruism, ethics,
            and professionalism. In addition, the roles nurses per-
            form are often integrated into philosophy statements.
            Examples are caregiver, advocate, collaborator, case
            manager, health educator, counselor, leader, and re-
            searcher. Themes specific to school nursing relate to
            the population served-children, families, and staff-
            and the settings where care is delivered-the school
            and the community. Specific goals of school nursing
            may be articulated and include the prevention of dis-
            ease, the promotion and maintenance of health, and
            creation of an optimal environment for learning. Oth-
            er important ideas are issues in today’s society related
            to the allocation of resources and the delegation of
            care.

            Finally, the philosophy statement should end with
            a few sentences of how personal values articulate with
            values about nursing. Concluding statements could re-
            late to striving for balance and profession growth
            through continued learning. Caring for oneself as well
            as others is a critical issue for busy nurses, as is being
            a good role model for health in our homes, schools,
            and communities. The final statement often relates to
            how you hope to make a difference-in yourself or in
            your home, school, community, or the world.
            My first experience in articulating a philosophy of

            nursing was when I was completing a master’s degree
            in nursing of children. A class assignment forced me
            to synthesize my personal beliefs with what I had
            learned about caring for children and families. Al-
            though the requirements were for a short statement,
            the time taken to list these values and then organize
            them into a cohesive whole was daunting. What re-
            sulted was a meaningful statement that I still share
            with students today, 30 years later. This experience has
            inspired me to challenge others to take the same step
            and create their own personal philosophy of nursing.

            by guest on August 11, 2016jsn.sagepub.comDownloaded from

            2

            Through the years I have assigned graduate stu-
            dents in my nursing education and child health nurs-
            ing classes to write their own philosophy of nursing
            education or child health nursing. Most find this as-
            signment a meaningful part of their professional
            growth and an appropriate capstone experience at the
            end of their master’s degree program. More recently, I
            have been teaching a course on the Art and Science of
            Nursing to beginning nursing students and have re-
            quired them to write a philosophy of nursing. Their
            enthusiasm and ability to capture the essence of nurs-
            ing and the many roles nurses perform in today’s
            health care system have been amazing, considering
            the point where they are in their career. As they com-
            plete their baccalaureate program, students will have
            an opportunity to update or rewrite their philosophy
            as they enter the profession of nursing.

            The box below has a short philosophy of life I re-
            cently created to provide students an example on how
            to capture some personal beliefs on paper. It pulls to-
            gether some of the priorities that influence both my
            personal and professional life. Writing these down has
            helped me refocus my energies on what is really im-
            portant to me, especially at a time when competing
            demands often overshadow important values and how
            my time is used.

            Readers, I encourage each of you to take some time
            as we enter a new year to create your personal philos-
            ophy of nursing. Consider the ideas presented in this
            editorial as a starting point in identifying what is im-
            portant to you. Next, pull these ideas together in a
            short statement that reflects your personal and pro-
            fessional values. Each philosophy statement will be
            uniquely you. It may not be perfect or all inclusive,
            but it is an effort to clarify what you believe. As you

            review your philosophy, seriously consider how this
            statement will guide your practice as a school nurse.
            When you complete your philosophy, I encourage you
            to send me a copy. If I have a good response, I will
            share some of your ideas in a future editorial.

            Like life, a statement of philosophy is a work in
            progress. It is ever changing as we change and as the
            world around us changes. Saving earlier versions pro-
            vides evidence of our personal and professional
            growth over the years. Making the effort to articulate
            your values in a one-page statement is a valuable

            learning strategy for nurses today as we strive to pro-
            vide the best quality care to children and families. Fre-
            quently it gives us an opportunity to really examine
            what we believe and how this fits with our personal
            and professional lives. When there is not congruence
            between one’s philosophy and one’s personal or pro-
            fessional life, it provides the motivation to reconcile
            these differences. The development of a personal phi-
            losophy is an opportunity to explore what we believe.
            It is an inspiring, growth-producing experience. A phi-
            losophy statement expresses our unique values and
            goals that ultimately guide our practice as professional
            nurses.

            Janice Denehy, RN, PhD, Executive Editor

            REFERENCES

            American Nurses’ Association. (1985). Code for nurses with inter-
            pretive statements. Washington, DC: Author.

            Chitty, K. K. (2001). Professional nursing: Concepts and challenges
            (3rd ed.). Philadelphia: WB Saunders.

            National Association of School Nurses. (1998). Standards of profes-
            sional school nursing practice. Scarborough, ME: Author.

            by guest on August 11, 2016jsn.sagepub.comDownloaded from

            research

            O R I G I N A L R E S E A R C H

            Effects of Domiciliary Professional Oral Care for
            Care-Dependent Elderly in Nursing Homes – Oral
            Hygiene, Gingival Bleeding, Root Caries and
            Nursing Staff’s Oral Health Knowledge and
            Attitudes

            This article was published in the following Dove Press journal:
            Clinical Interventions in Aging

            Caroline
            Girestam Croonquist1,2

            Jesper Dalum 3

            Pia Skott1,2

            Petteri Sjögren4

            Inger Wårdh2,3

            Elisabeth Morén 3

            1Folktandvården Stockholm AB,
            Stockholm, Sweden; 2Academic Centre
            Of Geriatric Dentistry, Stockholm,
            Sweden; 3Department Of Dental
            Medicine, Karolinska Institutet,
            Huddinge, Sweden; 4Oral Care AB,
            Stockholm, Sweden

            Purpose: The primary aim was to describe the effects for nursing home residents of monthly
            professional cleaning and individual oral hygiene instruction provided by registered dental
            hygienists (RDHs), in comparison with daily oral care as usual. The secondary aim was to
            study the knowledge and attitudes among nursing staff regarding oral health care and needs.
            Patients and Methods: In this randomised controlled trial (RCT), 146 residents were
            recruited from nine nursing homes in Regions of Stockholm and Sörmland and were
            randomly assigned (on nursing home level) to either intervention group (I; n=72) or control
            group (C; n=74). Group I received monthly professional cleaning, individual oral hygiene
            instructions and information given by an RDH. Group C proceeded with daily oral care as
            usual (self-performed or nursing staff-assisted). Oral health-related data was registered with
            the mucosal-plaque score index (MPS), the modified sulcus bleeding index (MSB), and root
            caries. The nursing staff’s attitudes and knowledge were analysed at baseline and at six-
            month follow-up. Statistical analysis was performed by Fisher’s exact test and two-way
            variance analysis (ANOVA).
            Results: Improvements were seen in both Group I and Group C concerning MPS, MSB and
            active root caries. The nursing staff working with participants in Group I showed significant
            improvements regarding the Nursing Dental Coping Beliefs Scale (DCBS) in two of four
            dimensions, oral health care beliefs (p=0.0331) and external locus of control (p=0.0017)
            compared with those working with Group C. The knowledge-based questionnaire showed
            improvement (p=0.05) in Group I compared with Group C.
            Conclusion: Monthly professional oral care, combined with individual oral health care
            instructions, seems to improve oral hygiene and may reduce root caries among nursing home
            residents. This may also contribute to a more positive attitude regarding oral hygiene
            measures among nursing home staff, as compared with daily oral care as usual.
            Keywords: aged, residential facilities, nursing staff, dental care, attitude of health personnel,
            oral health

            Introduction
            With an ageing population, the need for care support for dependent elderly
            increases for the general public.1 Domiciliary dental care enables dental services
            in the patients’ residences and offers the opportunity to provide regular check-ups,

            Correspondence: Elisabeth Morén
            Department Of Dental Medicine,
            Karolinska Institutet, Box 4064, Huddinge
            141 04, Sweden
            Tel +46 70 165 88 03
            Email elisabeth.moren@ki.se

            Clinical Interventions in Aging Dovepress
            open access to scientific and medical research

            Open Access Full Text Article

            submit your manuscript | www.dovepress.com Clinical Interventions in Aging 2020:15 1305–1315 1305

            http://doi.org/10.2147/CIA.S236460

            DovePress © 2020 Girestam Croonquist et al. This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.
            com/terms.php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By

            accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly
            attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php).

            C
            lin

            ic
            a

            l I
            n

            te
            rv

            e
            n

            tio
            n

            s
            in

            A
            g

            in
            g

            d
            o

            w
            n

            lo
            a

            d
            e

            d
            f

            ro
            m

            h
            tt

            p
            s:

            //
            w

            w
            w

            .d
            o

            ve
            p

            re
            ss

            .c
            o

            m
            /

            o
            n

            0
            8

            -F
            e

            b
            -2

            0
            2

            2
            F

            o
            r

            p
            e

            rs
            o

            n
            a

            l u
            se

            o
            n

            ly
            .

            preventive measures and dental treatments to individuals
            who experience difficulties attending a regular dental
            clinic.2 The dental care performed at home by dental
            personnel is rudimentary, with rather simple equipment
            and treatments like scaling of calculus, tooth extractions,
            tooth restorations, adjustments of dentures and plaque
            removal.3 A study conducted by Wårdh et al (2012)3

            regarding nursing staff’s knowledge and attitudes towards
            oral health care showed that the majority of the nursing
            staff believed that the residents would tell them when they
            needed help with their daily oral hygiene. Furthermore, the
            majority felt that performing assisted oral care (tooth-
            brushing, interproximal tooth cleaning and/or cleaning of
            prothesis) was a difficult task and 80% thought the greatest
            obstacle was the non-cooperation from the residents.
            Keboa et al (2019) presented, from a nursing staff per-
            spective on performing assisted oral care, that challenges
            lie in complicated teeth constructions, high workload,
            resistance towards examine another person’s oral cavity/
            mouth, and not wanting to performed assisted oral care.4

            Residents at nursing homes may face difficulties visiting
            a dental clinic,5 and a study by Muszalik et al (2015)6 of
            patients visiting a geriatric clinic showed that elderly per-
            sons often have difficulties participating in activities outside
            their home environment. The major issues were the lack of
            energy and the presence of pain. Today, elderly in devel-
            oped countries retain their teeth at a higher age,7–9 but
            ageing with increased morbidity and polypharmacy often
            results in frailty and dependence on the care of others, all of
            which increase the risk of deterioration of oral health and
            susceptibility to developing oral diseases.10,11 The rela-
            tively high number of natural teeth and complicated oral
            prosthetic constructions (eg, bridges, crowns and oral
            implants),7,12,16 together with progressing morbidity and
            care dependence, necessitates that daily oral hygiene activ-
            ities need to be maintained on a sufficient level, or even
            intensified.7 The presence of oral health conditions can
            cause pain, infections and nutritional difficulties.7,8 The
            common condition oral dryness increases the risk of dental
            caries, which can relatively rapidly lead to deterioration of
            oral health.13,14 Additionally, it can cause a social handicap
            since oral dryness can lead to difficulties speaking, chewing
            and swallowing, impairment in tasting,14,15 and have
            a negative impact on quality of life.14,16,17

            Oral and general health are strongly related in older
            individuals16,18 and maintained oral health among the
            elderly has been related to retained general health.19,20

            A study conducted by Hagglund et al (2019)12 showed

            that the mortality risk observed over one year was signifi-
            cantly higher in older individuals with poor oral health
            than in those with good oral health. Furthermore, it has
            been shown that intensified oral care interventions by
            dental personnel may prevent approximately one in ten
            deaths from healthcare-associated pneumonia (NNT
            8.6–11).21 Both natural teeth and dentures may constitute
            a reservoir for respiratory pathogens,22 and denture wear-
            ing at night doubles the risk of healthcare-associated pneu-
            monia in the oldest adults.23 Barbe et al (2019)24

            concluded that professional cleaning performed by
            a dental nurse every two weeks on residents living at
            nursing homes maintained and improved the residents’
            oral health. Furthermore, domiciliary dental care provides
            the possibility of reaching individuals with, for example,
            cognitive impairment and/or functional limitations.19,25

            The primary aim of this study was to describe the
            effects for nursing home residents of professional cleaning
            and individual oral hygiene instruction provided by regis-
            tered dental hygienists (RDHs), in comparison with daily
            oral care as usual. The secondary aim was to study the
            knowledge and attitudes among nursing staff regarding
            oral health care and needs.

            The hypothesis was that domiciliary prophylactic pro-
            fessional oral care will improve oral health among partici-
            pants in the intervention group, in comparison with
            participants in a control group that receives daily oral
            care as usual.

            Materials and Methods
            This evaluator-blinded RCT with an open-ended design
            was performed at nine Swedish nursing homes. One hun-
            dred and forty-six residents were recruited to participate in
            the study; 72 were randomised to the intervention group
            (Group I) and 74 to the control group (Group C).

            Ethical Statement
            The study was approved by the Ethics Committee in
            Stockholm, Sweden (Number 2015/1641-31/2) and was
            registered in ClinicalTrial.gov (Number NCT02669979).

            Randomisation and Recruitment of the
            Nursing Homes
            Four nursing homes in Region Stockholm and five nursing
            homes in Region Sörmland were recruited to the study.
            Randomisation was performed at nursing home level.26

            The nursing homes were chosen geographically (urban and

            Girestam Croonquist et al Dovepress

            submit your manuscript | www.dovepress.com

            DovePress

            Clinical Interventions in Aging 2020:15 1306

            Powered by TCPDF (www.tcpdf.org)

            rural areas) and were managed by both private companies
            and municipalities. Approval from the head of the nursing
            home was mandatory for inclusion in the study. After col-
            lecting informed consent (for residents showing signs of
            reduced cognitive function according to Pfeiffer-test,27

            informed consent was required from either a relative or an
            advocate), the randomisation of the nursing homes to either
            Group I or Group C was decided by a computer-generated
            sequence and administrated by a coded letter representing
            each nursing home. The letter was opened by an RDH not
            otherwise involved in the clinical examinations in the study.

            The inclusion criteria were living in a nursing home,
            ≥85 years of age, and at least ten remaining teeth including
            dental implants. Exclusion criteria were having full den-
            tures, edentulous, reduced cognitive function that made
            cooperation impossible for examination and treatment by
            RDHs, extreme dry mouth assessed by the mirror-sliding
            friction test28 and ASA risk qualification of 4 or higher.29

            The taking of antiplatelet drugs and anticoagulants was not
            an exclusion criterion but was noted in the study protocol
            during data collection.

            Study Process
            At baseline, participants in both study groups received
            professional cleaning (tooth brushing, interproximal clean-
            ing and scaling of supragingival calculus) performed by
            three calibrated and blinded RDHs. Home care instructions
            regarding oral hygiene were given verbally and in writing
            to participants in both study groups and to nursing staff,
            and fluoridated toothpaste, a soft toothbrush and interprox-
            imal cleaning aids were given free of charge.

            Intervention
            The participants in Group I received monthly professional
            cleaning, individual oral hygiene instructions and informa-
            tion by RDHs (not otherwise involved in the oral exam-
            ination and study protocol registration). The visiting time
            was approximately 30 minutes.

            Control
            The participants in Group C received the same baseline
            procedure as Group I and proceeded with daily oral care as
            usual, performed either by themselves or assisted by nur-
            sing staff, throughout the study, without any additional
            visits or instructions by a study RDH.

            Oral Examination and Study Protocol
            Oral examination was performed by using a flashlight, mir-
            ror and probe at baseline and the results were registered in
            a study protocol (available on request) together with med-
            ical history and medication use. Indexes used were the
            mucosal-plaque score index (MPS),30 modified sulcus
            bleeding index (MSB)31 and root caries. Oral mouth dry-
            ness was measured by the participants’ subjective experi-
            ences and the mirror-sliding friction test28 on the inside of
            the buccal mucosa. Registrations according to the study
            protocol were performed in both groups by the three cali-
            brated RDHs at baseline, after three months and after six
            months (Figure 1).

            Indexes
            MPS is a combined mucosal score and plaque score index
            used both for edentulous and dentate individuals. Before
            oral measurements, dental prostheses were removed if
            present. Mucosal score (MS) rates changes in the oral

            Figure 1 Flow chart over clinical registrations according to the study protocol, the total number of residents and also for the intervention group (I) and the control group
            (C) throughout the study. From baseline to the end of the study at six-month follow-up. Instruments: Mucosal and plaque score index (MPS), modified sulcus bleeding index
            (MSB) and root caries.

            Dovepress Girestam Croonquist et al

            Clinical Interventions in Aging 2020:15 submit your manuscript | www.dovepress.com
            DovePress

            1307

            Powered by TCPDF (www.tcpdf.org)

            mucosa, and plaque score (PS) rates the amount of plaque
            both on natural teeth and on removable dentures and fixed
            prosthodontics. MS and PS are rated from 1 to 4 (4 is the
            most severe). By interpretation of the index, MS and PS
            are combined. The purpose of the index is to validate oral
            hygiene and not to serve as a diagnosis.30

            MSB was used to measure bleeding from the gingival
            margin on the buccal surface of the Silness-Loe index
            teeth12,16,24,32,36,44 or, when missing, the closest tooth32

            was assessed according to MSB, which has four levels
            (0–3) where 3 is the most severe.31

            Root caries33 was assessed according to five levels on
            the buccal surface on Silness-Loe index teeth.

            Nursing Staff
            Nursing staff from four nursing homes participated in this
            part of the study, with a total of 50 participants included.
            The intervention group contained 35 participants at base-
            line and 20 participants at six-month follow-up. The con-
            trol group contained 15 participants at baseline and 15
            participants at follow-up. Twelve participants from the
            intervention group and 2 participants from the control
            group could be followed using a four-digit code number
            from baseline to six-month follow-up and were therefore
            designated as the identified group.

            Study Process
            All nursing staff (nursing aides, assistant nurses, registered
            nurses and other staff such as administrators and man-
            agers) participated in an oral health education programme
            at study start, given by one RDH who was not otherwise
            involved in the study.

            Intervention
            The nursing staff’s knowledge and attitude towards oral
            health were registered prior to participating in the educa-
            tional programme at baseline using two questionnaires. The
            questionnaires were repeated at the six-month follow-up.

            Questionnaires
            The questionnaires used were the Nursing Dental Coping
            Belief Scale (Nursing DCBS)34 questionnaire and
            a knowledge-based questionnaire regarding oral health.35

            Both questionnaires were distributed to the current nursing
            staff working at the nursing homes that day, at baseline
            and at six-month follow-up. The questionnaires were pseu-
            donymised with a four-digit code number.

            The nursing DCBS index is a tool used to measure how
            groups of nursing staff differ in their priorities and how they

            meet their responsibilities for oral health care.34 The DCBS
            was developed by Jacobs & Stewart and is based on three
            major models of cognitive behavioural psychology consisting
            of Julian Rotter’s locus of control (divided into IL and EL),
            Albert Bandura’s self-efficacy and Donald Meichenbaum’s
            self-instructional technique.36 The DCBS consists of four
            dimensions: “internal locus of control (IL)”, “external locus
            of control (EL)”, “self-efficiency (SE)” and “oral health-care
            beliefs (OHCB)” and has been used in various types of care-
            related research.37 The IL dimension evaluates people’s self-
            control and self-experienced beliefs concerning events in life,
            for example, “I believe brushing can help prevent cavities”,
            and people with high degrees of IL expect themselves to have
            great control and responsibility over events in life. In contrast,
            people with high degrees of EL expect and believe that their
            lives are influenced by environmental factors outside their own
            control, for example, “No matter how hard I work on taking
            care of my teeth, I still get tooth decay”.36 The SE dimension
            evaluates people’s beliefs concerning their own capability to
            affect a specific situation,38 for example, “I believe I know
            how to brush my teeth correctly”.36 The OHBC dimension
            evaluates faulty and irrational beliefs about dental disease,38

            for example, “Once gum disease has started it is almost
            impossible to stop”.36 The responses in DCBS are listed on
            a scale, with five options ranging from “strongly agree” to
            “strongly disagree”, including a “do not know” option.34

            The Handbook of Healthcare was the second question-
            naire used in the study and is based on questions regarding
            knowledge about oral health needs in care-dependent
            elderly. It was retrieved from www.vardhandboken.se,
            which is a website that was initiated by the Swedish
            Association of Local Authorities and Regions to provide
            education and support to care providers. The questionnaire
            consists of nine questions about the use of dental pros-
            theses and how to clean them, oral dryness, oral hygiene
            performance, Revised Oral Health Assessment Guide
            (ROAG), etc. Each correct answer gives 1 point and zero
            points are awarded for incorrect answers.35

            Statistics
            The data collected at baseline were presented with mean
            values and standard deviations (SD) or as frequencies. The
            results were presented with changes from baseline to the
            three- and six-month follow-ups in frequency tables.
            Comparisons between Group I and Group C were made
            using Fisher’s exact test. P values <0.05 (95% CI) were
            considered statistically significant.

            Girestam Croonquist et al Dovepress

            submit your manuscript | www.dovepress.com

            DovePress

            Clinical Interventions in Aging 2020:15 1308

            Powered by TCPDF (www.tcpdf.org)

            Statistical methods used for the knowledge and attitude
            questionnaires were two-way variance analysis (ANOVA)
            and Fisher’s exact test.

            The participants (both the residents and the nursing
            staff) were treated as independent groups during analysis.
            The study was originally planned to last for one year but
            was concluded at six months due to financial reasons.

            Results
            Residents
            The mean number of natural teeth was 20.2 (SD 3.0) and 26%
            of the study participants received assisted oral care. Ninety-six
            percent had contact with dental care providers in the
            previous year. The mean prescribed medication was 9.7 (SD
            3.8) and 29% of the participants were registered with dry
            mouth according to self-experienced reports and the mirror-
            sliding friction test. A total of 14 participants used their electric
            toothbrush daily and strained food was medically prescribed
            for 3% of the participants. Additional baseline data are pre-
            sented in Table 1. Of the 146 included residents, a total of 124
            residents completed the entire study. Reasons for dropouts
            were events of death or hospitalization. There were more
            women than men in the total study material but no statistical
            difference between Groups I and C existed at baseline.

            Oral Hygiene and Root Caries
            MPS
            For MPS, improvements from baseline to six-month fol-
            low-up were seen in both Group I and Group C. Both

            groups showed improved PS, but without significance.
            For MS, a significant difference between Group I and
            Group C (p=0.04) was seen within the period between
            the three- and six-month follow-ups. In Group I, 20% of
            the participants showed improved MS, in comparison with
            13% in Group C (Tables 2–4).

            MSB
            The MSB index was combined and is presented as MSB 0
            +1 and MSB 2+3. For Group I and Group C, an improve-
            ment throughout the study could be seen within the groups
            (Table 5).

            Root Caries
            The root caries index was reduced from five levels to three
            and is presented as healthy (caries score of 1), initial caries
            lesion (caries score of 2 and 4) and active caries lesion
            (caries score of 3 and 5). Improvements were seen in both
            Group I and Group C for healthy and initial caries lesions
            throughout the study period, without significant difference
            between the groups. The last follow-up period between three
            to six months showed improvement for Group I regarding
            active caries lesions, with an improvement of 17% in com-
            parison with 4% in Group C (p=0.05) (Table 6–8).

            Nursing Staff
            The Nursing Staff’s Knowledge and Attitudes
            The intervention group showed a statistically significant
            improvement in comparison with the control group in the

            Table 1 Baseline Data For Residents

            Group I (n=72) Group C (n=74) Total (n=146)

            Age, mean value (SD) 89 (4.0) 88.7 (4.2) 88.9 (4.1)

            Men, n (%) 16 (22) 22 (29.7) 38 (26.0)

            Natural teeth, mean value (SD) 20.5 (2.9) 19.9 (3.1) 20.2 (3.0)
            Implants, n (%) 5 (6.7) 7 (9.5) 12 (8.2)

            Removable partial denture, n (%) 9 (12.5) 10 (13.5) 19 (13)

            Removable full denture, n (%) 1 (1.14) 0 (0) 1 (0.7)
            Got help with daily oral hygiene, n (%) 16 (22.2) 22 (29.7) 38 (26.0)

            Used fluoride toothpaste, n (%) 70 (97.2) 65 (87.8) 135 (92.5)

            Tooth brushing/day, mean value (SD) 1.7 (0.5) 1.8 (0.6) 1.8 (0.6)
            Interproximal cleaning/week, n (%) 30 (44.4) 30 (40.5) 60 (42.5)

            Used electric toothbrush, n (%) 9 (12.5) 5 (6.8) 14 (9.6)

            No dental exam/dental check-up > 12 months, n (%) 5 (6.9) 1 (1.4) 6 (4.1)
            Number of prescribed medications, mean value (SD) 9.8 (3.8) 9.5 (3.8) 9.7 (3.8)

            Dry mouth, n (%) 26 (36.1) 16 (21.6) 42 (28.8)

            Strained food, n (%) 2 (2.8) 3 (4.1) 5 (3.4)
            Nutritional drinks, n (%) 12 (16.7) 5 (6.8) 17 (11.6)

            Abbreviations: n, number; SD, standard deviation.

            Dovepress Girestam Croonquist et al

            Clinical Interventions in Aging 2020:15 submit your manuscript | www.dovepress.com
            DovePress

            1309

            Powered by TCPDF (www.tcpdf.org)

            OHCB dimension (p=0.03) and EL dimension (p=0.0017).
            In the identified group, there was a statistically significant
            difference in the IL dimension group (p=0.03).

            For the knowledge-based questionnaire, an improve-
            ment (p=0.05) was found between the intervention and
            the control group from baseline to six-month follow-up.

            Table 2 Plaque Score (PS) from Baseline (B) Among The Intervention (I) and Control (C) Group to Three- and Six-Month Follow-Ups

            PS B–3 Months B–6 Months 3–6 Months

            p-value 0.24 0.34 0.80

            I (n=70) C (n=61) I (n=69) C (n=55) I (n=69) C (n=55)

            Deteriorated n (%) 4 (5.71) 7 (11.48) 3 (4.35) 3 (5.45) 16 (23.19) 11 (20.00)

            Unchanged n (%) 33 (47.14) 21 (34.42) 40 (57.97) 25 (45.45) 44 (63.77) 35 (63.64)

            Improved n (%) 33 (47.14) 33 (54.10) 26 (37.68) 27 (49.09) 9 (13.04) 9 (16.36)

            Abbreviations: n, number of participants.

            Table 3 Mucosal Score (MS) from Baseline (B) Among the Intervention (I) and Control (C) Group to Three- and Six-Month Follow-
            Ups

            MS B–3 Months B–6 Months 3–6 Months

            p-value 0.10 0.12 0.04*

            I (n=70) C (n=61) I (n=69) C (n=55) I (n=69) C (n=55)

            Deteriorated n (%) 11 (15.71) 4 (6.56) 8 (11.59) 1 (1.82) 17 (24.64) 6 (10.91)

            Unchanged n (%) 22 (31.43) 29 (47.54) 31 (44.93) 28 (50.91) 38 (55.07) 42 (76.36)
            Improved n (%) 37 (52.86) 28 (45.90) 30 (43.48) 26 (47.27) 14 (20.29) 7 (12.73)

            Notes: *p <0.05. All other comparisons, not significant.
            Abbreviations: n, number of participants.

            Table 4 Mucosal And Plaque Score (MPS) from Baseline (B) Among the Intervention (I) and Control (C) Group to Three- And Six-
            Month Follow-Ups

            MPS B–3 Months B–6 Months 3–6 Months

            p-value 0.77 0.42 0.51

            I (n=70) C (n=61) I (n=69) C (n=55) I (n=69) C (n=55)

            Deteriorated n (%) 10 (14.29) 6 (9.84) 7 (10.14) 3 (5.45) 24 (34.78) 14 (25.45)

            Unchanged n (%) 13 (18.57) 13 (21.31) 24 (34.78) 16 (29.09) 30 (43.48) 29 (52.73)

            Improved n (%) 47 (67.14) 42 (68.85) 38 (55.07) 36 (65.45) 15 (21.74) 12 (21.82)

            Abbreviations: n, number of participants.

            Table 5 Modified Sulcus Bleeding Index (MSB) at Baseline (B), and After Three- And Six-Month (M) Follow-Ups and Difference (Diff)
            Between Time, Intervention (I) and Control (C) Group

            Baseline 3 Months Diff B–3M 6 Months Diff B–6M

            I n=72 C n=74 I n=70 C n=61 I n=70 C n=61 I n=69 C n=55 I n=69 C n=55

            MSB level 0–1

            mean (SD)

            2.07

            (1.70)

            1.66

            (1.12)

            2.15

            (1.70)

            1.79

            (0.94)

            0.08 0.13 2.41

            (1.76)

            2.30

            (1.14)

            0.34 0.64

            MSB level 2–3
            mean (SD)

            0.98
            (1.54)

            1.35
            (1.04)

            0.84
            (0.26)

            1.28
            (0.63)

            − 0.14 − 0.07 0.59
            (0.13)

            0.70
            (1.47)

            − 0.39 − 0.65

            Notes: MSB 0–1 positive values show improvement, MSB 2–3 negative values show improvement.

            Girestam Croonquist et al Dovepress

            submit your manuscript | www.dovepress.com

            DovePress

            Clinical Interventions in Aging 2020:15 1310

            Powered by TCPDF (www.tcpdf.org)

            Discussion
            The present study was a part of a project with the aim to
            evaluate regular professional cleaning and information/
            instructions regarding oral health care performed in nur-
            sing homes.2 It concluded that professional cleaning has
            a favourable effect on gingival bleeding, and verbally
            given individual oral hygiene instruction resulted in
            greater reduction of dental plaque, which indicates that
            both education and individual oral hygiene instruction
            with “hands-on” training ought to be included in domicili-
            ary oral health care programmes.2 In the present study, the
            intervention has therefore been a combination of these two
            parts. Furthermore, a root caries index and the knowledge
            and attitudes of nursing staff towards oral health care were
            added to the study design.
            <

            Research

            Discuss the individual and/or community needs as it relates to the reason for your capstone research inquiry. Why do you believe your research inquiry/findings will address the identified needs that prompted your inquiry?

            Research

            Instructions for Literature Review assignment:

            Based on the topic of interest, each student will write a literature review that describes the issue under study (problem statement), background information obtained from previous research studies conducted on this topic, the purpose of the proposed research study, the significance of the research study (knowledge gaps that need to be filled), and the research question and hypothesis of the study.

            The literature review should be 5to 7pages in length. It should be formatted in Times New Roman font, size 12, 1-inch margins, and double-spaced. All pages, except the cover page, should be numbered. Proper grammar and spelling are required.  

            AT LEAST five (5) primary references should be used. PDF versions of these references must be uploaded along with the literature review. All references (primary and secondary) should be formatted in APA format. References must be included as in-text citations in the body of the literature review and in the reference list at the back. The reference list does not count towards the page limit.

            i add the first revision bibliography

            i need to reorder the research question to 

            How biofilm affect the patient recovery at the hospital,

            and in the Annotated Bibliography has to be focus in What type of patient have biofilm 

            and what is biofilm and the general information

            Helpful APA Resources – Purdue University APA Formatting and Style Guide:

            Research

            a. Read the posted article above.

            b. Refer to Chapter 6 pages 120 to121  of your assigned textbook for more guidance. 

            c. Respond to the questions below by reviewing the article and identifying those elements (state the page number you found the element). If you indicate you support the researcher use of the element, make sure your findings are with literature (eg. you can reference your textbook where it says that element is important in qualitative research). 

            Your critique responses should reflect the following:
            1. What type of qualitative approach did the researcher use?
            2. what type of sampling method did the researcher use? Is it appropriate for the study?
            3. Was the data collection focused on human experiences?
            4. Was issues of protection of human subjects addressed?
            5. Did the researcher describe data saturation?
            6. What procedure for collecting data did the researcher use?
            7. What strategies did the researcher use to analyze the data?
            8. Does the researcher address credibility (can you appreciate the truth of the patient’s experience), auditability (can you follow the researcher’s thinking, does the research document the research process) and fittingness are the results meaningful, is analysis strategy compatible with the purpose of the study) of the data?

            9.  What is your cosmic question? (This is a question you ask your peers to respond to based on the chapter discussed in class this week i.e. Qualitative studies).

            Research

            28 American Nurse Journal Volume 15, Number 6 MyAmericanNurse.com

            ALL NURSES are expected to understand and
            apply evidence to their professional practice.
            Some of the evidence should be in the form
            of research, which fills gaps in knowledge,
            developing and expanding on current under-
            standing. Both quantitative and qualitative re-
            search methods inform nursing practice, but
            quantitative research tends to be more empha-
            sized. In addition, many nurses don’t feel
            comfortable conducting or evaluating qualita-
            tive research. But once you understand quali-
            tative research, you can more easily apply it to
            your nursing practice.

            What is qualitative research?
            Defining qualitative research can be challeng-
            ing. In fact, some authors suggest that provid-
            ing a simple definition is contrary to the
            method’s philosophy. Qualitative research ap-
            proaches a phenomenon, such as a clinical
            problem, from a place of unknowing and at-
            tempts to understand its many facets. This
            makes qualitative research particularly useful
            when little is known about a phenomenon
            because the research helps identify key con-

            Introduction to
            qualitative

            nursing
            research

            This type of research
            can reveal important

            information that
            quantitative

            research can’t.

            By Jennifer Chicca, MS, RN, CNE, CNE-cl

            STRICTLY CLINICAL RESEARCH 101

            MyAmericanNurse.com June 2020 American Nurse Journal 29

            cepts and constructs. Qualitative research sets
            the foundation for future quantitative or qualita-
            tive research. Qualitative research also can stand
            alone without quantitative research.

            Although qualitative research is diverse,
            certain characteristics—holism, subjectivity,
            intersubjectivity, and situated contexts—guide
            its methodology. This type of research stresses
            the importance of studying each individual as
            a holistic system (holism) influenced by sur-
            roundings (situated contexts); each person de-
            velops his or her own subjective world (sub-
            jectivity) that’s influenced by interactions with
            others (intersubjectivity) and surroundings (sit-
            uated contexts). Think of it this way: Each
            person experiences and interprets the world
            differently based on many factors, including
            his or her history and interactions. The truth is
            a composite of realities.

            Qualitative research designs
            Because qualitative research explores diverse
            topics and examines phenomena where little
            is known, designs and methodologies vary.
            Despite this variation, most qualitative re-
            search designs are emergent and holistic. In
            addition, they require merging data collection
            strategies and an intensely involved re-
            searcher. (See Research design characteristics.)

            Although qualitative research designs are
            emergent, advanced planning and careful
            consideration should include identifying a
            phenomenon of interest, selecting a re-
            search design, indicating broad data collec-
            tion strategies and opportunities to enhance
            study quality, and considering and/or setting
            aside (bracketing) personal biases, views,
            and assumptions.

            Many qualitative research designs are used
            in nursing. Most originated in other disci-
            plines, while some claim no link to a particu-
            lar disciplinary tradition. Designs that aren’t
            linked to a discipline, such as descriptive de-
            signs, may borrow techniques from other
            methodologies; some authors don’t consider
            them to be rigorous (high-quality and trust-
            worthy). (See Common qualitative research
            designs.)

            Sampling approaches
            Sampling approaches depend on the quali-
            tative research design selected. However, in
            general, qualitative samples are small, nonran-
            dom, emergently selected, and intensely stud-

            ied. Qualitative research sampling is con-
            cerned with accurately representing and dis-
            covering meaning in experience, rather than
            generalizability. For this reason, researchers tend
            to look for participants or informants who are
            considered “information rich” because they
            maximize understanding by representing
            varying demographics and/or ranges of expe-
            riences. As a study progresses, researchers
            look for participants who confirm, challenge,
            modify, or enrich understanding of the phe-
            nomenon of interest. Many authors argue that
            the concepts and constructs discovered in
            qualitative research transcend a particular
            study, however, and find applicability to oth-
            ers. For example, consider a qualitative study
            about the lived experience of minority nursing
            faculty and the incivility they endure. The
            concepts learned in this study may transcend
            nursing or minority faculty members and also
            apply to other populations, such as foreign-
            born students, nurses, or faculty.

            A sample size is estimated before a quali-
            tative study begins, but the final sample size
            depends on the study scope, data quality,
            sensitivity of the research topic or phenome-
            non of interest, and researchers’ skills. For ex-
            ample, a study with a narrow scope, skilled

            Most qualitative research designs share the following characteristics.

            Characteristic Description Example

            Emergent

            Holistic

            Intensely

            involved

            researcher

            Merging data

            collection

            strategies

            Research design characteristics

            • Flexible
            • Adaptable
            • Changes to
            reflect realities
            and viewpoints,
            which may not
            be known at the
            outset

            • Considers the
            whole

            • Detailed study

            • Many strategies
            are used to
            capture holism

            A researcher completing a ground-
            ed theory study changes the inter-
            view questionnaire, based on pre-
            liminary findings, to include more
            focused questions to help saturate
            theoretical categories

            A researcher completing a histori-
            cal research study analyzes arti-
            facts, journals, interviews, docu-
            ments, photographs, and records
            to understand a past event

            A researcher completing an ethno-
            graphic inquiry spends time
            (sometimes years) interviewing,
            observing, and perhaps even par-
            ticipating in the studied culture

            A researcher completing a case
            study analyzes interviews, observa-
            tions, documents, and records to
            understand the identified case

            30 American Nurse Journal Volume 15, Number 6 MyAmericanNurse.com

            researchers, and a nonsensitive topic likely
            will require a smaller sample. Data saturation
            frequently is a key consideration in final sam-
            ple size. When no new insights or informa-
            tion are obtained, data saturation is attained
            and sampling stops, although researchers may
            analyze one or two more cases to be certain.
            (See Sampling types.)

            Some controversy exists around the con-
            cept of saturation in qualitative nursing re-
            search. Thorne argues that saturation is a con-
            cept appropriate for grounded theory studies
            and not other study types. She suggests that
            “information power” is perhaps more appro-
            priate terminology for qualitative nursing re-
            search sampling and sample size.

            Data collection and analysis
            Researchers are guided by their study design
            when choosing data collection and analysis
            methods. Common types of data collection in-
            clude interviews (unstructured, semistructured,

            focus groups); observations of people, envi-
            ronments, or contexts; documents; records; ar-
            tifacts; photographs; or journals. When collect-
            ing data, researchers must be mindful of
            gaining participant trust while also guarding
            against too much emotional involvement, en-
            suring comprehensive data collection and
            analysis, conducting appropriate data manage-
            ment, and engaging in reflexivity.

            Reflexivity involves systematically analyz-
            ing each step of the research process. Unlike
            quantitative researchers, who use validated in-
            struments, qualitative researchers themselves
            are the instruments. They must strive to attain
            and manage high-quality data. Journaling can
            help researchers identify and manage how
            their behaviors and thoughts influence their
            study findings. When researchers bracket their
            preconceived notions when collecting and an-
            alyzing data, they help increase study rigor.

            Data usually are recorded in detailed notes,
            memos, and audio or visual recordings, which

            Qualitative nursing research can take many forms. The design you choose will depend on the question you’re trying to answer.

            Design Originating discipline Description Sample nursing research question

            Action research Education Conducted by and for What happens to the quality of nursing practice
            those taking action to when we implement a peer-mentoring system?
            improve or refine actions

            Case study Many In-depth analysis of an entity How is patient autonomy promoted by a unit?
            or group of entities (case)

            Descriptive N/A Content analysis of data What is the nursing role in end-of-life decisions?

            Discourse analysis Many In-depth analysis of written, What discourses are used in nursing practice and
            vocal, or sign language how do they shape practice?

            Ethnography Anthropology In-depth analysis of a How does Filipino culture influence childbirth
            culture experiences?

            Ethology Psychology Biology of human behavior What are the immediate underlying psycho-
            and events logical and environmental causes of incivility
            in nursing?

            Grounded theory Sociology Social processes within a How does the basic social process of role
            social setting transition happen within the context of
            advanced practice nursing transitions?

            Historical research History Past behaviors, events, When did nurses become researchers?
            conditions

            Narrative inquiry Many Story as the object of How does one live with a diagnosis of
            inquiry scleroderma?

            Phenomenology Philosophy Lived experience What is the lived experience of nurses who were
            Psychology admitted as patients on their home practice unit?

            Common qualitative research designs

            MyAmericanNurse.com June 2020 American Nurse Journal 31

            frequently are transcribed verbatim and ana-
            lyzed manually or using software programs,
            such as ATLAS.ti, HyperRESEARCH, MAXQDA,
            or NVivo. Analyzing qualitative data is com-
            plex work. Researchers act as reductionists,
            distilling enormous amounts of data into con-
            cise yet rich and valuable knowledge. They
            code or identify themes, translating abstract
            ideas into meaningful information. The good
            news is that qualitative research typically is
            easy to understand because it’s reported in
            stories told in everyday language.

            Evaluating a qualitative study
            Evaluating qualitative research studies can
            be challenging. Many terms—rigor, validity,
            integrity, and trustworthiness—can describe
            study quality, but in the end you want to know
            whether the study’s findings accurately and
            comprehensively represent the phenomenon
            of interest. Many researchers identify a quality
            framework when discussing quality-enhance-
            ment strategies. Example frameworks include:
            • Trustworthiness criteria framework, which

            enhances credibility, dependability, con-
            firmability, transferability, and authenticity

            • Validity in qualitative research framework,
            which enhances credibility, authenticity, criti-
            cality, integrity, explicitness, vividness, creativ-
            ity, thoroughness, congruence, and sensitivity.
            With all frameworks, many strategies can

            be used to help meet identified criteria and
            enhance quality. (See Research quality en-
            hancement). And considering the study as a
            whole is important to evaluating its quality
            and rigor. For example, when looking for ev-
            idence of rigor, look for a clear and concise
            report title that describes the research topic
            and design and an abstract that summarizes
            key points (background, purpose, methods, re-
            sults, conclusions). (Visit myamericannurse.com/
            ?p=66448 to learn what other questions to ask
            when evaluating a qualitative study.)

            Application to nursing practice
            Qualitative research not only generates evi-
            dence but also can help nurses determine pa-
            tient preferences. Without qualitative research,
            we can’t truly understand others, including their
            interpretations, meanings, needs, and wants.
            Qualitative research isn’t generalizable in the
            traditional sense, but it helps nurses open their
            minds to others’ experiences. For example,
            nurses can protect patient autonomy by under-

            standing them and not reducing them to univer-
            sal protocols or plans. As Munhall states, “Each
            person we encounter help[s] us discover what is
            best for [him or her]. The other person, not us,
            is truly the expert knower of [him- or herself].”
            Qualitative nursing research helps us under-
            stand the complexity and many facets of a
            problem and gives us insights as we encourage
            others’ voices and searches for meaning.

            When paired with clinical judgment and
            other evidence, qualitative research helps us
            implement evidence-based practice success-
            fully. For example, a phenomenological in-
            quiry into the lived experience of disaster

            Several sampling types guide qualitative research, and because designs
            are emergent, sampling may change as a study progresses. In grounded
            theory, for instance, sampling moves into more focused theoretical sam-
            pling as a study progresses. The researcher may return to a participant
            and question him or her more specifically about a theoretical construct,
            such as the concept of “making it work” in a study about having a child
            with a disability. This sampling approach helps ensure theoretical cate-
            gories become saturated.

            Sampling type Comments

            Convenience or volunteer • Participants readily available
            • Easy, efficient
            • Might not be “information rich”

            Purposive • Participants selected because they
            benefit the study (for example,
            selecting for varying demographics or
            ranges of experience)

            Shadow • Participants speak of others’
            experiences in addition to their own

            Snowball or chain • Early participants refer others
            • Easy, efficient
            • Might not be “information rich”

            Theoretical • Participants selected based on
            manifestation of theoretical constructs

            Sampling types

            32 American Nurse Journal Volume 15, Number 6 MyAmericanNurse.com

            workers might help expose strengths and
            weaknesses of individuals, populations, and
            systems, providing areas of focused interven-
            tion. Or a phenomenological study of the
            lived experience of critical-care patients might
            expose factors (such dark rooms or no visible
            clocks) that contribute to delirium.

            Successful implementation
            Qualitative nursing research guides under-
            standing in practice and sets the foundation for
            future quantitative and qualitative research.
            Knowing how to conduct and evaluate quali-
            tative research can help nurses implement ev-
            idence-based practice successfully. AN

            Jennifer Chicca is a PhD candidate at the Indiana University of
            Pennsylvania in Indiana, Pennsylvania, and a part-time faculty
            member at the University of North Carolina Wilmington.

            References
            Amankwaa L. Creating protocols for trustworthiness in
            qualitative research. J Cult Divers. 2016;23(3):121-7.

            Cuthbert CA, Moules N. The application of qualitative
            research findings to oncology nursing practice. Oncol
            Nurs Forum. 2014;41(6):683-5.

            Guba E, Lincoln Y. Competing paradigms in qualitative

            research. In: Denzin NK, Lincoln YS, eds. Handbook of
            Qualitative Research. Thousand Oaks, CA: SAGE Publi-
            cations, Inc.;1994: 105-17.

            Lincoln YS, Guba EG. Naturalistic Inquiry. Thousand
            Oaks, CA: SAGE Publications, Inc.; 1985.

            Munhall PL. Nursing Research: A Qualitative Perspective.
            5th ed. Sudbury, MA: Jones & Bartlett Learning; 2012.

            Nicholls D. Qualitative research. Part 1: Philosophies. Int
            J Ther Rehabil. 2017;24(1):26-33.

            Nicholls D. Qualitative research. Part 2: Methodology.
            Int J Ther Rehabil. 2017;24(2):71-7.

            Nicholls D. Qualitative research. Part 3: Methods. Int J
            Ther Rehabil. 2017;24(3):114-21.

            O’Brien BC, Harris IB, Beckman TJ, Reed DA, Cook DA.
            Standards for reporting qualitative research: A synthesis
            of recommendations. Acad Med. 2014;89(9):1245-51.

            Polit DF, Beck CT. Nursing Research: Generating and
            Assessing Evidence for Nursing Practice. 10th ed.
            Philadelphia, PA: Wolters Kluwer; 2017.

            Thorne S. Saturation in qualitative nursing studies: Un-
            tangling the misleading message around saturation in
            qualitative nursing studies. Nurse Auth Ed. 2020;30(1):5.
            naepub.com/reporting-research/2020-30-1-5

            Whittemore R, Chase SK, Mandle CL. Validity in qualita-
            tive research. Qual Health Res. 2001;11(4):522-37.

            Williams B. Understanding qualitative research. Am
            Nurse Today. 2015;10(7):40-2.

            Several strategies can be used to enhance qualitative research quality.

            Quality-enhancement strategy Description

            Audit trial Transparently describing all research processes (data collection and analysis methods)

            Comprehensive field notes Recording thoughts, topics, etc., before, during, or after data collection

            Data saturation When no new insights or information are obtained and redundancy is achieved

            Member checking Sharing study results (themes, codes) with participants and obtaining critical feedback

            Peer review and debriefing Evaluating study processes and outcomes by peers (other investigators)

            Prolonged engagement and Spending sufficient time (scope) and focus (depth) in study efforts to gain complete
            persistent observation understanding of the phenomenon of interest (for example, through extended
            field observations)

            Recording transcription Transcribing audio and/or video recordings of data (for example, interviews,
            observations) verbatim

            Reflexivity Systematically analyzing all steps of the research process (for example, via journaling)

            Theoretical sampling Sampling on the basis of manifestation of theoretical constructs to further develop
            a theory

            Triangulation Obtaining and using multiple data sources, methods, investigators, theories, analysts

            Vivid descriptions Making the phenomenon studied explicit by providing detailed accounts

            Research quality enhancement

            Research

            Civic Engagement Term Project

            the “public good”/ “problem”from a microbiology perspective: Homelessness in San Francisco.

            Academic and Statistical Research [CLO 2]

            Find (at least) two different academic sources (e.g., journal articles) that provide insight into why your identified problem/issue is important in your community (e.g., rising costs of medications, vaccination rates in the community, understanding of antimicrobial substances by the community, etc.). For each article:

            1. Summarize the findings.

            2. State any statistics that are important to your problem.

            3. Critique the article with respect to to critical components (see below)

            4. Explain how this article relates to your problem.

            research

            The Journal of Dental Hygiene 33 Vol. 94 • No. 6 • December 2020

            Abstract
            Purpose: The purpose of this study was to investigate the effects of a professional oral health care program on the oral health
            status and salivary flow of elderly people living in nursing homes.

            Methods: Elderly residents aged ≥ 65 years, living in a nursing home, were randomly assigned to either a one-week interval, two-
            week interval, or control group, and received an oral health intervention accordingly over a period of 12 weeks. Plaque index,
            tongue coating, gingival index, and salivary flow rate were compared before and after the oral health intervention within and
            between the groups.

            Results: The plaque, tongue coating, and gingival indices of the participants who received the oral health intervention
            decreased significantly; while the salivary flow rate significantly increased. Plaque, tongue coating, and gingival indices
            decreased most significantly in the one-week interval group, followed by the two-week interval group, relative to the control.
            The salivary flow rate increased most significantly in the one-week interval group, followed by the two-week interval group.

            Conclusion: A professional oral health care program is effective for improving the oral health and salivation of elderly
            residents in nursing homes and the effect was found to be greater with interventions provided at one-week intervals. Oral
            health care professionals, including dentists and dental hygienists, must regularly monitor and manage the oral health of
            elderly residents.

            Keywords: oral health promotion, oral health intervention, elderly, nursing home residents, oral health care, dental
            hygienists, caregivers

            This manuscript supports the NDHRA priority area: Client level: Oral health care (Health promotion: treatments,
            behaviors, products).

            Submitted for publication: 3/11/20; accepted: 6/18/20.

            Effects of Professional Oral Health Care Programs for Elderly
            Residents of Nursing Facilities
            Kyeong Hee Lee, RDH, PhD; Keun Yoo Lee, RDH, PhD; Yoon Young Choi, DDS, PhD;
            Eun Seo Jung, RDH, PhD

            Research

            Introduction
            It can be challenging for most elderly nursing home

            residents to implement oral health care independently due to
            chronic disease, disabilities, or decreased cognitive function
            and assistance in performing activities of daily living are often
            required.1 Poor oral health can lead to oral diseases, which can
            decrease quality of life (QOL) and increase mortality risk.2
            Moreover, the elderly, particularly those in nursing facilities,
            often have chronic illnesses requiring medications with adverse
            oral side effects, such as xerostomia.3 While regular oral health
            care is critical to maintain the QOL of the elderly in nursing
            homes, it often receives a low intervention priority.4

            The lack of onsite dental clinics at Korean nursing homes
            is a barrier to dental care for elderly residents living in such

            facilities.5 Residents with oral health problems must visit the
            local clinic with the help of the nursing home staff, which can
            pose challenges. To address this access to care issue, the Korean
            government reformed the regulations to include dentists
            in the definition of “part-time visiting doctors” providing
            medical services in geriatric care facilities. However, general
            doctors and dentists are commissioned by the individual
            geriatric care facilities. Many of these facilities have chosen to
            extend their contract with the general medical practitioners
            who have been visiting the facility, rather than employ part-
            time visiting dentists. Hence, the oral health care of elderly
            residents is mostly managed by the institutional caregivers.

            The Journal of Dental Hygiene 34 Vol. 94 • No. 6 • December 2020

            Caregivers often regard oral care provision for the residents
            as a minimal part of their overall work.6 Even when the
            caregiver is committed to the care of these individuals, proper
            oral health care provision is hindered by the caregiver’s lack of
            professional education and training in geriatric oral health care.7
            A recent qualitative study of caregivers revealed that methods
            and level of oral care provision for elderly residents varied across
            facilities, depending on the level of commitment of the facility
            head.8 Choi emphasized the need for an oral health intervention
            program run by oral health professionals within the facility in
            order to provide quality dental service.9

            Most previous research on geriatric oral health care
            in nursing homes has targeted caregivers nursing the
            elderly.10-12 Some studies have utilized professional oral health
            care providers, but varied in terms of the method of care,
            intervention duration, and measurement index used.13,14 Lee
            et al.15 developed a one-week interval professional oral health
            care program based on the previous studies.13,14 Their findings
            demonstrated that elderly residents’ oral health status
            improved based on the intervention duration (4 weeks and
            12 weeks). However, the study failed to consider the effect
            of the intervention interval, as only a one-week interval was
            used, which is challenging at the practical level within in the
            context of almost non-existent professional oral health care.16

            The purpose of this study was to investigate the effects
            of implementing a professional oral health care program at
            different intervals, one week or two weeks, on the oral health
            status and salivary flow rate (SFR) of the elderly living in
            nursing care facilities.

            Methods
            Sample population

            The target population was elderly persons aged ≥ 65 years
            residing in nursing homes in the Gyeonggi and Chungcheong
            Provinces in the Republic of Korea. Nursing homes were
            selected through convenience sampling, and informed
            consent was obtained. Each participant was assigned to
            either a one-week interval group, two-week interval group,
            or control group; participants were either bed-ridden patients
            with complete dependence in activities of daily living (ADL)
            or demonstrated partial dependence in ADL. Inclusion
            criteria were individuals who had not received any dental
            care within the past 6 months. Individuals who refused to
            open their mouth due to severe cognitive impairment, those
            with Sjögren’s syndrome, or those who were on salivation
            stimulation medication were excluded from the study.

            A power analysis was performed to determine the minimum
            sample size required for the t-test and was calculated using

            G*Power 3.1 for Windows. For a significance level of 0.05, effect
            size of 0.5, and power of 0.85, at least 38 subjects per group
            were required, however, considering drop-out, 135 participants
            (45 per group) was set as the sample size. Shinhan University
            Institutional Review Board approved the study. Additionally,
            informed consent from all participants was obtained following
            the explanation of the study objective and method of
            participation. In cases of elderly patients with communication
            difficulties, consent from guardians was received.

            To test for homogeneity of the group participants, data on
            general characteristics, long-term care insurance (LTCI) level,
            length of stay (LOS), cognitive function, ADL performance,
            and general health- and oral health-related characteristics
            were collected via a questionnaire. Initial information
            regarding gender, age, education level, and participant-
            partner living arrangement was received prior to starting
            the questionnaire. The Korean version of Mini-Mental State
            Examination (MMSE-K)17 was used to measure cognitive
            function. ADL performance was assessed using the modified
            Barthel index, which had been revised to reflect Korean
            culture and standardized by Jeong et al.18 Data were collected
            on the following categories: number of chronic illnesses,
            number of current medications, recent bouts of pneumonia,
            daily oral care, refusal of oral care, and xerostomia. General
            characteristics and cognitive function were asked directly to
            residents and answers were recorded accordingly. Activities of
            daily living performance and general health- and oral health-
            related characteristics were assessed by the nursing staff, social
            worker, or caregiver.

            Intervention

            The professional oral health care program was implemented
            for 12 weeks; at one-week intervals in the one-week interval
            group, and at two-week intervals in the two-week interval group.
            In the control group, no professional oral health care program
            was implemented. The intervention was designed based on the
            research method used previously by Lee et al.,15 and was further
            modified and supplemented through expert consultation with a
            dentist, two dental hygiene professors, and two clinical dental
            hygienists. Professional oral care was performed by four dental
            hygienists and lasted about six minutes per participant. To avoid
            any experimenter bias, the study participants were randomly
            assigned to the same dental hygienist each time. Dental
            hygienists were blinded to group selection.

            The professional oral health care intervention was carried
            out according to the following procedures. The lip area was
            first cleaned with gauze soaked in a disinfectant mixture
            of saline and mouth rinse (Listerine, McNeil Consumer
            Healthcare; Fort Washington, PA, USA). Vaseline Petroleum

            The Journal of Dental Hygiene 35 Vol. 94 • No. 6 • December 2020

            jelly was then applied to the lips. For participants with
            dentures, each denture was removed and cleaned of debris
            via a suction device. The teeth and tongue were cleaned using
            a combination of rolling brushing, Watanabe brushing,
            and Bass brushing methods. Interdental brushes were used
            to clean the interproximal areas in the posterior region.
            The participant was then asked to rinse with water. If the
            participant had difficulty with rinsing, a suction device was
            used to remove the water. After removing debris in the oral
            cavity, the tongue was wiped using a sponge brush soaked in
            chlorhexidine and squeezed to remove excess. A moisturizer
            was then applied. The buccal mucosa was massaged using
            either the handle of a toothbrush or a finger, the upper/lower
            lips were stretched outwards for five seconds for each of three
            cycles, and the buccal and lingual gingivae were massaged
            using the thumb and index finger. Areas of the parotid,
            submandibular, and sublingual glands were massaged ten
            times each. Each participant was provided with an interdental
            brush and a sponge brush, which were replaced once every
            two months and at each visit, respectively. Patients wearing
            dentures were provided with denture cleansers.

            Outcome measures

            The oral health status pre- and post-intervention was
            examined to evaluate the effects of the professional oral
            healthcare program. The O’Leary index,19 Winkel Tongue
            Coating Index,20 Löe & Silness gingival index,21 and salivary
            flow rate (SFR),22 were measured. Additionally, an oral
            examination was performed by a single dentist and post-
            intervention oral health status was assessed in all groups,
            three days after program termination.

            The O’Leary index19 is a quantitative measurement of
            individual oral status. Disclosing agent was applied to all
            teeth. Each tooth was first divided into four surfaces (mesial,
            distal, buccal, lingual) and the coloring on each surface
            was recorded as a score of 0 for “No plaque” or 1 for “With
            plaque,” indicating poorer hygiene control. The occlusal and
            incisal surfaces and any missing teeth were excluded from
            measurement.

            Tongue coating was evaluated using the Winkel Tongue
            Coating Index (WTCI).20 With the patient’s mouth wide
            open, the tongue was divided into six sections, two vertical
            sections from tip to base and three horizontal sections. Tongue
            coating for each section was rated as 0 for “No coating,” 1 for
            “Light coating,” or 2 for “Heavy coating.” The sum of these
            scores (range: 0-12) indicated the total amount of coating.

            The Löe & Silness gingival index21 is widely used for
            measuring the level of periodontal disease by examining four
            sections (mesial, distal, buccal, lingual) of the gingival margin.

            For each section, the level of inflammation was evaluated as 0
            for “No inflammation,” 1 for “Mild inflammation with slight
            changes in color and edema, but no bleeding on probing,”
            2 for “Moderate inflammation with redness, edema, and
            bleeding on probing,” and 3 for “Severe inflammation with
            redness, hyperplasia, and spontaneous bleeding.” The total
            sum of the scores was then divided by the total number of
            gingival margins examined, with 0 indicating healthy gingiva.

            Salivary flow rate was measured using the swab method.22
            Without having brushed their teeth for two hours following
            breakfast, participants were asked to swallow to void the
            mouth of saliva prior to measurement. Dental cotton rolls
            were placed in the mouth (1.3 × 3.2 cm, Richmond Dental
            Company; Charlotte, NC, USA): one under the ventral
            surface (sublingual salivary gland) and one each in the left
            and right maxillary buccal regions (submandibular salivary
            glands). After five minutes without any movement, the cotton
            rolls were removed and their weight was measured using a
            CB Series (CB-200) digital scale with a resolution of 0.01 g
            (A&D Co., Ltd., Jinchoen, Korea).

            Data analysis

            Data was analyzed using SPSS Statistics software
            (version 22.0, IBM Corporation, Armonk, NY, USA) and
            the significance level was set to 0.05. A chi-square test was
            conducted for categorical variables, For continuous variables,
            one-way analysis of variance (ANOVA) with Scheffe’s post-
            hoc test was performed. Analysis of covariance (ANCOVA)
            was conducted to compare post-intervention-measured
            values between groups. However, SFR was not identified
            as a significant interaction term for ANCOVA. Therefore,
            the homogeneity of pre-intervention measurement values
            was first verified. Then, inter-group comparison of post-
            intervention measurements was then performed using one-
            way ANOVA. To identify pre-to-post changes, a paired t-test
            was performed.

            Results
            Evaluation of the general characteristics, LTCI level, LOS,

            cognitive function, and ADL performance revealed that all
            variables except for cognitive function were not significantly
            different among the groups (Table I). No general health-
            or oral health-related characteristics differed significantly
            among the groups, confirming their homogeneity (Table II).
            The one-week interval group and the control group mostly
            had two illnesses; all three groups typically used one to three
            medications. Most had no recent history of pneumonia;
            performed daily oral care, did not refuse oral care, or reported
            having xerostomia.

            The Journal of Dental Hygiene 36 Vol. 94 • No. 6 • December 2020

            The results of the paired t-tests comparing the effects of the professional oral care
            program are displayed in Table III. After intervention, the O’Leary index decreased by 0.90
            and by 0.47 in the one week and two-week interval groups, respectively (p < 0.001). There
            was no statistically significant change in the control group. The Winkel Tongue Coating
            Index decreased by 3.81 post-intervention in the one-week interval group (p < 0.001), but
            there was no significant change in the two-week interval or control groups.

            The Löe & Silness gingival index decreased post-intervention by 2.18 and 1.09 in the
            one-week and two-week interval groups, respectively (p < 0.05), with no significant change
            in the control group. The SFR increased post-intervention by 0.42 and 0.26 in the one-
            week and two-week interval groups, respectively (p < 0.05), and decreased by 0.08 in the
            control group (p < 0.05).

            The plaque index, gingival index, and tongue coating index decreased most significantly
            in the one-week interval group, followed by the two-week interval and lastly the control
            groups; while SFR increased most significantly in the one-week interval group, followed by
            the two-week interval group (p < 0.001).

            Discussion
            This study aimed to assess the effects of an oral health care intervention program on the

            oral health status and salivary flow of elderly residents living in a long-term care facility.
            Prior to the intervention, homogeneity across the one-week and two-week interval groups,
            as well as the control group, was confirmed; only cognitive function differed between the

            groups. Elderly residents in long-
            term care facilities frequently
            have difficulty performing oral
            care independently as a result of
            impaired cognition, mobility,
            or hand joint micromotion and
            are generally at high risk for oral
            diseases.23 Patients with impaired
            cognitive function tend to forget
            about personal oral health care,
            display resistant behavior to oral
            care performed by nursing staff,
            and have difficulty expressing oral
            pain or discomfort, if present.24
            Although participants’ cognitive
            function differed significantly
            across groups, the MMSE-K score
            was < 19 (dementia) in all groups,
            indicating general impairment.
            Moreover, the ADL score was
            25–49 in all groups, indicating
            maximum dependence.18 Since
            most of the participants required
            assistance, this study concluded
            that there was no problem with
            the homogeneity between groups.

            Pre and post evaluation
            revealed that plaque levels signi-
            ficantly decreased post-inter-
            vention in both of the intervention
            groups, consistent with previous
            findings.15 According to recent
            studies, oral health care is critical to
            preventing aspiration pneumonia
            in the elderly and oral function
            maintenance, muscle strength
            recovery, and mental health.16,25
            The present study demonstrated
            the effect of using a combination of
            various brushing methods to clean
            the tooth surface and an interdental
            brush to wipe the interdental and
            posterior surfaces.

            Elderly residents of nursing care
            homes can suffer hyposalivation
            due to adverse effects of multiple
            medications and the resultant
            increase in tongue coating can

            Table I. Participant demographics* (n=125)

            Characteristic
            1-week
            (n = 38)

            2-week
            (n = 43)

            Control
            (n = 44)

            p-value**

            Sex
            Male 10 (26.3) 8 (18.6) 4 (9.1)

            0.121
            Female 28 (73.7) 35 (81.4) 40 (90.9)

            Age (years) 82.63 ± 9.26 83.14 ± 8.13 85.02 ± 5.76 0.335

            Education

            None 15 (39.5) 19 (44.2) 23 (52.3)

            0.268Elementary school 14 (36.8) 14 (32.6) 7 (15.9)

            ≥ Middle school 9 (23.7) 10 (23.2) 14 (31.8)

            Living with
            partner

            Alive 6 (15.8) 11 (25.6) 8 (18.2)
            0.509

            Widowed 32 (84.2) 32 (74.4) 36 (81.8)

            LTCI
            level***

            Level 1 6 (15.8) 12 (27.9) 3 (6.8)

            0.069Level 2 17 (44.7) 12 (27.9) 22 (50.0)

            Level 3 15 (39.5) 19 (44.2) 19 (43.2)

            LOS (months)*** 15.92 ± 13.37 15.49 ± 12.12 18.48 ± 9.08 0.434

            MMSE-K*** 17.18 ± 6.98 a 15.07 ± 6.12 ab 13.16 ± 7.84 b 0.039

            ADL*** 33.45 ± 28.67 46.56 ± 33.07 34.14 ± 27.18 0.079

            *Data are presented as mean ± SD or n (%)

            **p-values of age, LOS, K-MMSE, and ADL performance were calculated using ANOVA, chi-square tests
            were used for the remainder.

            ***LTCI, long-term care insurance; LOS, length of stay; MMSE-K, Korean version of Mini-Mental State
            Examination; ADL, activities of daily living.

            The Journal of Dental Hygiene 37 Vol. 94 • No. 6 • December 2020

            lead to increased risk of malodor, caries,
            periodontal disease, and fungal infections (e.g.,
            oral candidiasis).26 A sponge brush containing
            chlor-hexidine was used to wipe the oral
            mucosa and tongue followed by the application
            of moisturizer. Tongue coating significantly de-
            creased in the one-week interval group, which
            was consistent with a previous study.15 Tongue
            coating decreased slightly in the two-week
            interval group, but not significantly. Reduction
            effects on tongue coating can vary depending
            on the intervention interval.

            The gingival index score also significantly
            decreased post-intervention in both inter-
            vention groups. According to Matthews et
            al.,27 66–74% of elderly residents in nursing
            homes have comorbid gingivitis and 32–49%
            require treatment for periodontal disease, a
            known risk factor of cardiovascular disease.28
            Efforts to prevent progression from gingivitis
            to periodontitis is necessary. The reduction
            of gingivitis and improvement of periodontal
            condition through oral hygiene care were
            confirmed in this study.

            Salivary gland hypofunction disrupts the
            normal homeostasis of the oral cavity, con-
            tributing to a range of oral diseases including
            dental caries, taste disturbances, candidiasis,
            and difficulties with swallowing, chewing, and
            speaking.29 Ohara et al. reported that oral health
            care, facial and tongue muscle exercises, and
            salivary gland massage can increase salivation
            in elderly patients with xerostomia.30 This study
            demonstrated that SFR significantly increased
            in both experimental groups after massaging
            the salivary glands and oral muscles, with a
            greater effect observed in the one-week interval
            group. This finding has important implications
            for stimulating salivary function.

            Across all measurement indices, the effects
            were two-fold greater in the one-week versus
            two-week interval group, which confirms that
            a shorter intervention interval more markedly
            improves the oral health status and SFR in
            the elderly, which has implications for the
            implementation of a professional oral health
            care program. However, this study only lasted
            12 weeks, and as such, does not reflect the

            Table II. General and oral health-related characteristics

            Characteristic Response
            1-week
            (n = 38)
            n (%)

            2-week
            (n = 43)

            n(%)

            Control
            (n = 44)

            n(%)
            p-value*

            Number
            of chronic
            illnesses

            ≤ 1 12 (31.6) 17 (39.5) 11 (25.0)

            0.5872 15 (39.5) 15 (34.9) 22 (50.0)

            ≥ 3 11 (28.9) 11 (25.6) 11 (25.0)

            Number
            of current
            medications

            ≤ 3 21 (55.3) 24 (55.8) 23 (52.3)

            0.8274-5 14 (36.8) 18 (41.9) 18 (40.9)

            ≥ 6 3 (7.9) 1 (2.3) 3 (6.8)

            Recent
            pneumonia

            Yes 3 (7.9) 2 (4.7) 0 (0.0)
            0.184

            No 35 (92.1) 41 (95.3) 44 (100.0)

            Capable of
            daily oral care

            Yes 25 (65.8) 20 (46.5) 26 (59.1)

            0.122Somewhat 7 (18.4) 19 (44.2) 11 (25.0)

            No 6 (15.8) 4 (9.3) 7 (15.9)

            Refusal of
            oral care

            Yes 8 (21.1) 19 (44.2) 13 (29.5)
            0.076

            No 30 (78.9) 24 (55.8) 31 (70.5)

            Xerostomia
            Yes 32 (84.2) 29 (67.4) 36 (81.8)

            0.138
            No 6 (15.8) 14 (32.6) 8 (18.2)

            *p-values were calculated using chi-square test.

            Table III. Comparison of plaque index, tongue coating index, gingival
            index, salivary flow rate

            Variables
            Pre-intervention

            Mean ± SD
            Post-intervention

            Mean ± SD
            p-value*

            Between groups
            p-value**

            Plaque index

            1-week 1.52 ± 1.53 0.62 ± 0.75 <0.001
            <0.0012-week 1.39 ± 1.40 0.92 ± 1.04 <0.001

            Control 1.50 ± 1.35 1.47 ± 1.36 0.237
            Tongue coating index

            1-week 5.92 ± 3.51 2.11 ± 2.86 <0.001
            <0.0012-week 5.14 ± 1.95 4.74 ± 2.21 0.215

            Control 4.68 ± 1.89 4.66 ± 1.90 0.323
            Gingival index

            1-week 2.76 ± 3.76 0.57 ± 2.04 <0.001
            <0.0012-week 2.65 ± 5.09 1.55 ± 3.45 0.002

            Control 5.02 ± 5.91 5.11 ± 5.81 0.781
            Salivary flow rate

            1-week 1.07 ± 1.30 1.50 ± 1.55 <0.001
            <0.0012-week 3.35 ± 0.49 3.61 ± 0.82 0.007

            Control 3.11 ± 0.40 3.02 ± 0.40 0.001
            *p-values were calculated using a paired t-test.
            **p-values of SFR were calculated using ANOVA and the remainder with ANCOVA.

            The Journal of Dental Hygiene 38 Vol. 94 • No. 6 • December 2020

            results of continued care. Future studies should evaluate the
            effects of implementing the program over a longer time frame.

            Limitations of this study include the small sample size and
            the possible inaccuracy of participant information related to
            general and oral health-related characteristics as obtained from
            the nursing staff responsible for the elderly resident. Future
            research should aim to enhance the sample both in size and
            representativeness.

            Conclusion
            Results from this study demonstrated that the

            implementation of a professional oral health care program
            enhances the oral health and salivation in the elderly.
            Accordingly, oral health professionals, dentists, and dental
            hygienists, should monitor and manage oral health of the
            elderly in long-term care facilities. Relevant guidelines
            for institutions need to be established requiring daily oral
            hygiene care and regular dental care to elderly residents in
            nursing homes.

            Disclosure
            This study was supported by a National Research

            Foundation of Korea grant funded by the Korean government
            (Ministry of Science and ICT; No. 2018R1A2B6006701).
            The funders had no role in the study design, data collection
            and analysis, or preparation of the manuscript.

            Kyeong Hee Lee, RDH, PhD is an associate professor,
            Department of Dental Hygiene, College of Bioecological
            Health, Shinhan University, Republic of Korea; Keun Yoo
            Lee, RDH, PhD is a medical consultation team leader, Asan-si
            Public Health Center, Republic of Korea; Yoon Young Choi,
            DDS, PhD is a research professor, Artificial Intelligence Big
            Data Medical Center, Yonsei University Wonju College of
            Medicine, Republic of Korea; Eun Seo Jung, RDH, PhD is an
            adjunct professor, Department of Dental Hygiene, College of
            Bioecological Health, Shinhan University, Republic of Korea

            Corresponding author: Eun Seo Jung, RDH, PhD;
            dentalmien@hanmail.net

            References
            1. Sung, K. Predictive factors associated with death of

            elderly in nursing homes. Asian Nurs Res. 2014 Jun; 8:
            143-9.

            2. Zenthöfer A, Rammelsberg P, Cabrera T, et al. Determinants
            of oral health-related quality of life of the institutionalized
            elderly. Psychogeriatrics. 2014 Dec; 14: 247-54.

            3. Tanigawa T, Yamashita J, Sato T, et al. Efficacy and
            safety of pilocarpine mouthwash in elderly patients with
            xerostomia. Spec Care Dentist. 2015 Feb; 35:164-9.

            4. Kwak JS, Woo SH, Lee JR. Recognition towards oral
            health care and plaque removal in the elderly people. J
            Korean Soc Dent Hyg. 2015 Aug; 15: 727-33.

            5. Ko SM, Lim SR. Oral hygiene care for elderly in care
            facility. J Korean Dent Assoc. 2015 Oct; 53: 678-87.

            6. Joen HS, Han SY, Chung WG, et al. Knowledge, attitude
            and behavior status on oral health care of geriatric care
            workers in long-term care facilities. J Dent Hyg Sci. 2015
            Oct; 15: 569-76.

            7. Kim GH, Kwon YS. A study on oral health perception
            and oral health-related quality of life of the elderly
            patients in a geriatric hospital. J Korean Soc Dent Hyg.
            2016 Jun; 16: 363-71.

            8. Jung ES, Choi YY, Lee KH. A qualitative study on the
            present conditions and problems of oral health care in
            senile dementia patients. J Korean Soc Dent Hyg. 2019
            Aug; 19: 601-14.

            9. Choi JS. Oral health status of long-term care facility
            residents. J Korean Soc Dent Hyg. 2017 Jun; 17: 527-37.

            10. Hoben M, Hu H, Xiong T, et al. Barriers and facilitators
            in providing oral health care to nursing home residents,
            from the perspective of care aides-a systematic review
            protocol. Syst Rev. 2016 Apr; 7: 53.

            11. Kim KM, Park YN, Lee MK, et al. Oral health knowledge
            level on oral care and elder oral hygiene care of the
            nursing home staff in long-term care facilities. J Korean
            Soc Dent Hyg. 2014 Oct; 14: 723-30.

            12. Baek JH, Lee HJ, Choi HJ, et al. Content analysis of
            daily tooth cleaning service records by caregivers in a
            long-term care facility. J Korean Soc Dent Hyg. 2014
            Dec; 14: 903-13.

            13. Choi SM. The effects of professional oral health care on oral
            health states of long-term care patients in geriatric hospital
            [dissertation]. Gyeongsan: Yeungnam University; 2012.

            14. Jeon YJ, Choi JS, Han SJ. The effect of dry mouth
            improvement by oral exercise program in elderly people.
            J Korean Soc Dent Hyg. 2012 Apr; 12: 293-305.

            15. Lee KY, Lim SR. Effect of professional oral healthcare
            program on the oral status of elderly residents in long-term
            care facilities. J Dent Hyg Sci. 2016 Dec; 16: 432-41.

            The Journal of Dental Hygiene 39 Vol. 94 • No. 6 • December 2020

            16. So JS. A study on the amendments of long-term care-
            related legislations for the introduction of part-time
            facility dentists. J Korean Dent Assoc. 2015 Oct; 53:
            696-704.

            17. Park JH, Kwon YC. Standardization of Korean version
            of mini-mental state examination (MMSE-K) for use
            in the elderly. Part II. Diagnostic validity. J Korean
            Neuropsychiatr Assoc. 1989 Mar; 28: 508-13.

            18. Jeong HY, Park BG, Shin HS, et al. Development of
            the Korean version of modified Barthel index (K-MBI):
            Multi-center study for subjects with stroke. Ann Rehabil
            Med. 2007; 31: 283-97.

            19. O’Leary TJ, Drake RB, Naylor JE. The plaque control
            record. J Periodontol. 1972 Jan; 43: 38.

            20. Winkel EG, Roldán S, Van Winkelhoff A, et al. Clinical
            effects of a new mouthrinse containing chlorhexidine,
            cetylpyridunium chloride and zinc-lactate on oral
            halitosis. A dual-center, double-blind placebo-controlled
            study. J Clin Periodontol. 2003 Apr; 30: 300-6.

            21. Löe H, Silness J. Periodontal disease in pregnancy I.
            Prevalence and Severity. Acta Odontol Scand. 1963 Dec;
            21: 533-51.

            22. Navazesh M, Christensen CM. A comparison of whole
            mouth resting and stimulated salivary measurement
            procedures. J Dent Res. 1982 Oct; 61: 1158-62.

            23. Vanobbergen JN, De Visschere LM. Factors contributing
            to the variation in oral hygiene practices and facilities in
            long-term care institutions for the elderly. Community
            Dent Health. 2005 Dec; 22: 260-5.

            24. Zuluaga DJ, Ferreira J, Montoya JA, Willumsen T. Oral
            health in institutionalised elderly people in Oslo, Norway
            and its relationship with dependence and cognitive
            impairment. Gerodontology. 2012 Jun; 29: e420–6.

            25. Shi Z, Xie H, Wang P, et al. Oral hygiene care for critically
            ill patients to prevent ventilator-associated pneumonia.
            Cochrane Database Syst Rev. 2013 Aug; 8: CD008367.

            26. Benn AM, Thomson WM. Saliva: an overview. N Z Dent
            J. 2014 Sep;110 :92-6.

            27. Matthews DC, Clovis JB, Brillant M, et al. Oral
            health status of long-term care residents: A vulnerable
            population. J Can Dent Assoc. 2012; 78: c3.

            28. Liccardo D, Cannavo A, Spagnuolo G, et al. Periodontal
            disease: a risk factor for diabetes and cardiovascular
            disease. Int J Mol Sci. 2019 Mar; 20: E1414.

            29. Villa A, Wolff A, Aframian D, et al. World Workshop
            on Oral Medicine VI: a systematic review of medication-
            induced salivary gland dysfunction: prevalence, diagnosis,
            and treatment. Clin Oral Investig. 2015 May; 19: 1563–80.

            30. Ohara Y, Yoshida N, Kono Y, et al. Effectiveness of an
            oral health educational program on community-dwelling
            older people with xerostomia. Geriatr Gerontol Int. 2015
            Apr; 15: 481-9.

            Copyright of Journal of Dental Hygiene is the property of American Dental Hygienists
            Association and its content may not be copied or emailed to multiple sites or posted to a
            listserv without the copyright holder’s express written permission. However, users may print,
            download, or email articles for individual use.

            Research

             Write the pathophysiology of the disease Cancer, include normal and abnormal pathophysiology of the impacted organ or body system, and the most common disease processes seen.This will include causes, prevalence, risk factors, population, and impacts of the disease process and include treatments. Do not re-write a textbook, do not copy and paste. This will be in your own words. Use APA format, 7th edition. This will be 3-4 typed pages excluding the title page and reference page.I need this in 16 hours 

            Research

            Civic Engagement

            Definitions of the civil engagement

            Civic engagement refers to how a person engages in a certain community and plays a positive impact into their life. (Hassan & Hamari, 2020). Another definition of the Civic engagement is defined as the action of an individual of collective people that is aimed at identifying a community gap and addressing it. (Fain, Munagala & Shah , 2018). There are many elements of civic engagement but the common are decision making, governance and also how the resources will be allocated. Based on the other definition, Civic engagement is the act of working of an individual or a group of people in order to make a certain difference in a given community. (Mirra ,2018) .In order to help a community, it requires a combination of an individual’s skills and knowledge.

            Having looked at the above three definitions of Civic engagement, according to my level of knowledge and skills. In my opinion, there are many benefits that result from civic engagement. Civil engagement can play an essential role in improving the relationship in the community as all the members in that community can develop a strong connection with one another. Civil engagement can help in growing and developing the community by providing the skills and knowledge thus making it better to adapt to their environment. Civil engagement can improve the quality of life as the community members can address their concerns and thus be able to influence the decision that can improve the quality of the life of the whole community.

            In my community, the problem that interferes with the public good is pollution. In recent years, there has been an increase in the population. This has led to the increase in waste products as there are no appropriate channels to dispose of the waste products. Environmental pollution, especially air pollution, has led to the emergence of many health problems. There are many diseases that arise as a result of environmental pollution. For example, an increase in the release of carbon dioxide results in acidic rainfall which devours the plants. Environmental pollution leads to an outbreak of water-borne diseases which is known to have killed many people all over the world.

            Based on the argument on pollution, It is one of the problems that affect the air which is a public good. Air plays an essential role in all living things. Without air, all the living things would have perished. Air pollution is the core cause of many diseases that humans experience. When harmful chemicals are released from the factories, they find their root in the atmospheres which eventually affect human beings in one way or another. There are many people in my society well-known for developing respiratory complications as a result of the air population.

            References

            Hassan & Hamari (2020). Gameful civic engagement: A review of the literature on gamification of e-participation. Government Information Quarterly, 37(3), 101461.

            Mirra (2018). Educating for empathy: Literacy learning and civic engagement. Teachers College Press.

            Fain, Munagala & Shah (2018, June). Fair allocation of indivisible public goods. In Proceedings of the 2018 ACM Conference on Economics and Computation (pp. 583).

            Research

            Please review the video with instructions regarding topic selection for the final paper. If you are unable to see the video, a transcript is attached. Once you select a topic, you will need to identify for your topic and write an outline of your research topic paper. This outline can follow the following format as far as section headings. But you do not have to follow it. You can add more sections. But there must be at least five sections highlighted by * and section titles. Include at least 100 words per section that you use.

            Abstract

            Introduction*

            Background

            Define your topic*

            Explain your topic*

            Defend your position about your topic*

            Conclusion*

            Summary

            Future Research Recommendation

            Incorporate at least one reference from articles listed within the online APUS library.

            •Written communication: Written communication is free of errors that detract from the overall message.
            •APA formatting: Resources and citations are formatted according to APA style and formatting.
            •Length of paper: typed, double-spaced pages with no less than two pages.
            •Font and font size: Times New Roman, 12 point

            Research

            CLB 475 – Seminar
            Spring 2022

            Methodology

            Each student will describe the research design that will be used for their proposed research
            project.

            The methodology should be divided into the following sections:

            1. Design – Describe the type of experimental design that will be used for the study

            2. Variables – Describe the independent variable and dependent variable/s

            3. Participants – Describe the participants that you will recruit for this study
            a. Inclusion criteria
            b. Exclusion criteria

            4. Controls
            a. What are the characteristics of the control group?
            b. Will the control group receive any treatment (any variables manipulated)?
            c. Are there any ethical issues with the control group, and if yes, how will these be

            handled?

            5. Sampling
            a. Describe the sampling methods that will be used to select participants (e.g.,

            random, stratified random, systematic random, cluster)
            b. How large will your sample size be (number in experimental group and number in

            control group)?

            6. Validity and Reliability
            a. How will validity be ensured?
            b. How will reliability be ensured?

            7. Data Collection Technique – Describe the technique that will be used to obtain and
            collect the data

            a. What technique will be used?
            b. When and how will the data collection instrument be administered?

            8. Research Ethics – Describe the informed consent form that will be provided to each
            participant

            a. How will you ensure that participation is completely voluntary (voluntary, refusal
            to participate, withdrawal from study)?

            b. Are you providing any rewards to the participants?
            c. Does participation pose any risks to participants?
            d. How will you ensure confidentiality of the data?

            CLB 475 – Seminar
            Spring 2022

            The methodology should be 1 to 2 pages in length. It should be formatted in Times New Roman
            font, size 12, 1-inch margins, and double-spaced. All pages, except the cover page, should be
            numbered. Proper grammar and spelling are required.

            ______________________________________________________________________________

            Rubric for Assessment of Methodology:

            1. Design – 1 point

            2. Variables – 2 points

            3. Participants – 2 point

            4. Controls – 1 point

            5. Sampling – 1 point

            6. Validity and Reliability – 1 point

            7. Data Collection Technique – 1 point

            8. Research ethics – 1 point

            Research

             

            2 of the theories from the list below to research in more detail:

            • Social Information Processing Theory
            • Hyper Personal Effect Theory
            • Warranting Theory
            • Social Identity Model of De-individuation Effects (also known as the SIDE mode

             

            Section 1

            • Summarize the first theory.
            • Provide 1 or 2 examples to illustrate the theory.
            • Explain how the theory complements the study of social or interpersonal psychology.

            Section 2

            • Summarize the second theory.
            • Provide 1 or 2 examples to illustrate the theory.
            • Explain how the theory complements the study of social or interpersonal psychology.

            Section 3

            • Compare and contrast the theories: How do they differ? How are they similar?

            Research

            Qualitative Approaches to Research

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Process of learning and constructing the meaning of human experience through intensive dialogue with persons who are living the experience
            • Rests on the assumption that there is a structure and essence to shared experiences that can be narrated

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Research question
            • Researcher’s perspective
            • Sample selection

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Data saturation- the situation of obtaining the full range of themes from the participants, so that in interviewing additional participants, no new data are emerging.

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Read the participants’ narratives
            • Extract significant statements
            • Formulate meanings for each of these significant statements
            • Repeat this process
            • Integrate the resulting themes
            • Reduce these themes to an essential structure
            • Return to the participants to conduct further interviews

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Inductive approach involving a systematic set of procedures to arrive at a theory about basic social processes
            • Widely used by social scientists, largely because it describes a research approach to construct theory where no theory exists or in situations where existing theory fails to provide evidence to explain a set of circumstances

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Identifying phenomena
            • Structuring the study
            • Data gathering
            • Data analysis
            • Theoretical sampling
            • Constant comparative method
            • Describing the findings

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Focuses on scientific description and interpretation of cultural or social groups and systems
            • The goal of the ethnographer is to understand the research participants’ views of their world, or the emic view.
            • Emic (insiders’) view differs from etic (outsiders’) view, which is obtained when the researcher uses quantitative analyses of behavior.

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • The view of the person experiencing the phenomenon and reflective of culture, values, beliefs, and experiences
            • What is it like to experience a particular phenomenon or to be part of a specific culture?

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Use quotes from participants
            • Group concepts into themes
            • Themes: labels that assist the reader in understanding an experience from the emic (insiders’) perspective

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Trustworthiness describes the credibility and validity of qualitative research.
            • The researcher promotes trustworthiness by using quotes to illustrate the richness of the data and to establish a relationship between the themes identified and the data.

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Phenomenon of interest

            What is the phenomenon of interest, and is it clearly stated?

            What is the justification for using a qualitative method?

            What are the philosophic underpinnings of the research method?

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Purpose

            What is the purpose of the study?

            What is the possible significance of the work to nursing?

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Method

            Is the method used to collect data compatible with the purpose of the research?

            Is the method adequate to address the phenomenon of interest?

            If a particular approach is used to guide the inquiry, is the study completed according to the processes described?

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Sampling

            What type of sampling is used? Is it appropriate given the particular method?

            Are the participants who were chosen appropriate to inform the research?

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Data collection

            Are data focused on human experience?

            Does the researcher describe data collection strategies (e.g., interview, observation, field notes)?

            Is protection of participants addressed?

            Is saturation of the data described?

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Data analysis

            What strategies are used to analyze data?

            Are steps described for data analysis followed?

            Are credibility, auditability, and fittingness of the data described?

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Credibility

            Do the participants recognize the experience as their own?

            Has adequate time been allowed to understand the phenomenon fully?

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Auditability

            Can the reader follow the researcher’s reasoning?

            Does the researcher document the research process?

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            Definition: criterion of scientific rigor for qualitative research when the research report leads the reader from the research question and raw data through the steps of analysis and interpretation of the data

            *

            • Fittingness

            Are the findings applicable to other, similar situations?

            Are the results meaningful to nursing?

            Is the strategy used for analysis compatible with the purpose of the study?

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Findings

            Are the findings presented within a context?

            Is the reader able to comprehend the “essence of the experience” from the report?

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Findings

            Are the researcher’s conceptualizations (themes) true to the data?

            Does the researcher place the report in the context of what is already known?

            Was the existing literature on the topic related to the findings?

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Conclusions, implications, and recommendations

            Do the conclusions, implications, and recommendations give a context to use the findings?

            Do the conclusions reflect the study findings?

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            • Conclusions, implications, and recommendations

            What are the recommendations for future study? Do they reflect the findings?

            How has the researcher made explicit the significance to nursing theory, research, or practice?

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Phenomenology

            Grounded theory

            Ethnography

            Case study

            Community-based participatory research

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            *

            Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

            ANSWER: E

            RATIONALE: Community-based participatory research (CBPR). Change or action is the intended “end-product” of CBPR, and action research is a term related to CBPR.

            *

            Research

            what is the impact COVID-19 might have on cancer .and its effects on the body system, including treatments, long-term effects, and emergency issues. Use only reputable sources such as CDC, ANA, and NCSBN. The NCSBN website has numerous posts regarding COVID-19. Write in two pages and at least two references. In APA format 7.I need this in 16hours. write in 500 words.

            Research

            Now add to the research on cancer , including community resources available for patients and families with this disease process.  BE SPECIFIC as to what the resource or foundation does to help,  how the patient contacts them, application processes if any, and so on. Be sure to include the mission or vision of the group as well. For some, you will have to dig deep. Remember the CDC and State Health Departments. Case managers and social workers can be a great source of information for these resources.

            Research

            Assignment 3 Rubric & Answers – Perry

            Question

            Answers

            Possible Points

            1.

            Is the study population identified and described? Are eligibility criteria specified?

            Study Population

            5

            Eligibility criteria

            5

            2.

            Dependent variable

            6

            3.

            Independent variable

            6

            4.

            What approach do the authors use to establish content validity?

            Content validity is the “degree to which an instrument has an appropriate sample of items for the construct being measured and adequately covers the construct domain.” To ensure a “content-valid” instrument, researchers should start with a conceptualization of the construct. This can be based on:

            · First-hand knowledge

            · Literature review

            · Expert consultations

            · Preliminary qualitative studies

            6

            5.

            What type of sampling plan was used? Would an alternative sampling plan have been preferable? Was the sampling plan one that could be expected to yield a representative sample?

            Sampling plan.

            5

            Alternative sampling plan

            2

            Sampling plan yielding representative sample

            2

            6.


            If sampling was stratified, was a useful stratification variable selected? If a consecutive sample was used, was the time period long enough to address seasonal or temporal variation?

            Stratification

            1

            Consecutive sampling

            1

            7.


            If cluster sampling was utilized, what were the clusters and how was sampling done within clusters?

            2

            8.

            How were people recruited into the sample? Does the method suggest potential biases?

            Recruitment

            4

            Potential biases

            4

            9.

            Did some factor other than the sampling plan affect the representativeness of the sample?

            5

            10.

            Are possible sample biases or weaknesses identified by the researchers themselves?

            5

            11.

            Are key characteristics of the sample described (e. g., mean age, percent female)? If yes, please provide detailed information on sample characteristics.

            12

            12.

            Was the sample size justified on the basis of a power analysis or other rationale?

            5

            13.

            What approach do the authors use to check for internal reliability?

            5

            14.

            What approach do the authors use to establish interrater reliability?

            2

            15.

            What approach do the authors use to establish test-retest reliability?

            2

            16.

            What approach do the authors use to establish discriminant validity?

            Discriminant validity is “the ability to differentiate a construct from other similar constructs.”

            5

            17.

            Does the sample support inferences about external validity? To whom can the study results reasonably be generalized?

            External validity

            5

            Generalizability

            5

            Source: Nursing Research: Generating and Assessing Evidence for Nursing Practice, 9th edition, p. 289.


            Research

             The final project is athree-partt activity. You will respond to three separate prompts but prepare your paper as one research paper. Be sure to include at least one school library source per prompt, in addition to your textbook (which means you’ll have at least 4 sources cited). Start your paper with an introductory paragraph. 

            Prompt 1 “Blockchain” (2-3 pages): Explain the major components of a blockchain. Be sure to include how blockchain is affecting the global economy and how you see it growing in the future.

             Prompt 2 “Big Data” (1-2 pages): Describe your understanding of big data and give an example of how you’ve seen big data used either personally or professionally. In your view, what demands is big data placing on organizations and data management technology?  How does big data affect a global economy? 

            Prompt 3 “Government and Policies” (1-2 pages):  Discuss the role government plays in a global economy.  Also, look at what policies are currently in place and then discuss what policies should be put in place. Conclude your paper with a detailed conclusion section. The paper needs to be approximately six to eight pages long, including both a title page and a references page (for a total of eight to ten pages). Be sure to use proper APA formatting and citations to avoid plagiarism. Your paper should meet these requirements: 

            • Be approximately six to eight pages in length, not including the required cover page and reference page.
            • Follow APA 7 guidelines. Your paper should include an introduction, a body with fully developed content, and a conclusion.
            • Support your answers with the readings from the course and at least two scholarly journal articles to support your positions, claims, and observations, in addition to your textbook. The school Library is a great place to find resources.
            • Be clearly and well-written, concise, and logical, using excellent grammar and style techniques. You are being graded in part on the quality of your writing.

            Research

            Research on the teaching plans on cancer. This plan will include the hospitalized AND discharged patient. Be sure to use the patient resources you found in the previous assignments such as support groups, include “usual” medications and treatments – physical therapy and of course home health or hospice. write in 300 words .put in a table form.need this in 14hours.

            research

            Literature Review

            Forest fires are defined as a fire that spreads without control or planning, on vegetation either in rural or urban areas. Forest fires are the leading cause of forest destruction in the world. In forest fires, in addition to trees and bushes, animals, houses, natural shelters for some species are also lost, sometimes the soil is irreversibly damaged, and many harmful gases are emitted into the atmosphere. These gases produced by forest fires, added to others produced by the burning of fossil fuels, contribute to increasing the temperature of our planet. This article is aimed at determining the effects on global warming of these forest fires.

            Global warming is one more phenomenon within the process of climate change that humanity faces today. Global warming is nothing more than the increase in the temperature of the atmosphere and for that reason more heat is retained than necessary, and the Earth overheats. This process is undoubtedly the most worrying consequence of climate change that we are facing. The consequences of this phenomenon have influenced the seasons of the year, making the hot months longer and more intense and the winters shorter. To analyze how forest fires are directly related to these changes and vice versa, our review is directed (Figueiras, S,2022).

            Different studies show curious data about the relationship between global warming and forest fires. There are different opinions as to whether there is a reciprocal effect between both events. According to (Schauenberg, 2020) in 2019 there were 400 thousand more forest fires worldwide than in 2018. What is worse: more than three times as many hectares were burned in the same period. But this has an explanation: global warming increases the risk of fires in forested areas. Almost all the most devastating megafires in the last 10 years have occurred in unusually hot climates (UN Environment, 2020).

            Does this mean that the cause of forest fires is climate change? Strictly speaking, the answer is no. Climate change does not produce forest fires since these do not generate spontaneously because of a drought. Climate change affects the fact that year after year there is a greater amount of combustible material that can easily start to burn, but it is not the trigger of the fires (Castillo, et al. 2019). In this regard, much literature and experts say that 90% of forest fires are caused by humans. The causes known as natural usually refer to isolated events such as lightning strikes in Andean areas affected by drought, which constitute only 1% of the origin of these fires (González, et al. 2020).

            This research has analyzed various sources to determine the causes and effects of forest fires on global warming. It is important to consider all the opinions about it; Citizens must be aware of the risk and take extreme precautions. In fact, the ideal is to look for alternatives to the use of fire when we are in wooded environments. The genetic diversity of plants in forest areas should be cared for and stimulated. If there is an overabundance of trees, this will cause more virulent fires because fires spread more easily.

            References

            Castillo, M., Saavedra, Jorge., Brull, J. (2019). Fire severity in mega wildfires.

            Shauenberg, T. (January 9, 2020). Forest fires: climate change and deforestation increase the global risk.

            UN Environment. (January 10, 2020). Are big fires part of a new normal? www.unenvironment.org

            https://www.ceupe.mx) (Figueiras, S,2022)

            https://www.cne.go.cr/reduccion_riesgo/informacion.)

            González, M.E., Sapiains, R., Gómez-González, S., Garreaud, R., Miranda, A., Galleguillos, M., Jacques, M., Pauchard, A., Hoyos, J., Cordero, L. , Vásquez, F., Lara, A., Aldunce, P., Delgado, V., Arriagada, Ugarte, A.M., Sepúlveda, A., Farías, L., García, R., Rondanelli, R., J., Ponce, R., Vargas, F., Rojas, M., Boisier, J.P., C., Carrasco, Little, C., Osses, M., Zamorano, C., Díaz-Hormazábal, I., Ceballos, A. , Guerra, E., Moncada, M., Castillo, I. (2020). Forest fires in Chile: causes, impacts, and resilience. Climate and Resilience Science Center (CR)2, (ANID/FONDAP/15110009), 84 pp.

            research

            Results

            The following graph tries to represent the behavior of the temperature, based on the warming of our planet over a period: incorporating the main idea investigated in each article and its relationship with. the subject studied by the researcher. You can see the increase in temperature. Chart, line chart, histogram  Description automatically generated You can see the increase in temperature

            research

            Method

            For this study, a meta-analysis method was used to synthesize different results found in some reviewed studies. An advanced internet search was carried out and keywords such as “global warming”, “climate change” and “forest fires” were used. Supposed to maintain updated information and reduce topics, the search was limited to research articles from the last five years, from 2018 to 2022. There was no limitation when searching literature in other languages, in an attempt not to limit our research. The search made provided access to multiple articles related to our topic, but only three were analyzed, For this study, a meta-analysis method was used to synthesize different results found in some reviewed studies. An advanced internet search was carried out and keywords such as “global warming”, “climate change” and “forest fires” were used. Supposed to maintain updated information and reduce topics, the search was limited to research articles from the last five years, from 2018 to 2022. There was no limitation when searching literature in other languages, in an attempt not to limit our research. The search made provided access to multiple articles related to our topic, but only three were analyzed, the rest were discarded. the rest were discarded.

            RESEARCH

            Mental Health Nurses’ Attitudes and Perceived Self-Efficacy Toward Inpatient Aggression

            12 Perspectives in Psychiatric Care 52 (2016) 12–24
            © 2014 Wiley Periodicals, Inc.

            Mental Health Nurses’ Attitudes and Perceived Self-Efficacy
            Toward Inpatient Aggression: A Cross-Sectional Study of
            Associations With Nurse-Related Characteristics
            Sofie Verhaeghe, PhD, RN,* Veerle Duprez, MSc, RN,* Dimitri Beeckman, PhD, RN, Joris Leys, MSc, RN,
            Berno Van Meijel, PhD, RN, and Ann Van Hecke, PhD, RN

            SofieVerhaeghe, PhD,RN, is Professor,UniversityCentre forNursingandMidwifery,Departmentof PublicHealth, FacultyofMedicineandHealth
            Sciences,GhentUniversity,Ghent, BelgiumandResearcher,DepartmentofNursing,VivesUniversityCollege Leuven,Roeselare, Belgium;Veerle
            Duprez,MSc,RN, is PhDstudent,UniversityCentre forNursingandMidwifery,Departmentof PublicHealth, FacultyofMedicineandHealthSciences,
            GhentUniversity,Ghent, BelgiumandLecturer&Researcher,DepartmentofBachelor inNursing,ArteveldeUniversityCollegeGhent,Ghent, Belgium;
            Dimitri Beeckman, PhD,RN, is Professor,UniversityCentre forNursingandMidwifery,Departmentof PublicHealth, FacultyofMedicineandHealth
            Sciences,GhentUniversity,Ghent, BelgiumandResearcher,DepartmentofBachelor inNursing,ArteveldeUniversityCollegeGhent,Ghent, Belgium;
            Joris Leys,MSc,RN, is Lecturer&Researcher,DepartmentofBachelor inNursing,ArteveldeUniversityCollegeGhent,Ghent, Belgium;BernoVan
            Meijel, PhD,RN, is ProfessorofMentalHealthNursing, ResearchGroupMentalHealthNursing, InhollandUniversity ofAppliedSciences,Amsterdam,
            Departmentof Psychiatry,VUUniversityMedicalCenter,AmsterdamandParnassia Psychiatric Institute, TheHague, TheNetherlands; andAnnVan
            Hecke, PhD,RN, is Professor,UniversityCentre forNursingandMidwifery,Departmentof PublicHealth, FacultyofMedicineandHealthSciences,
            GhentUniversity,Ghent, BelgiumandScientific Staff,NursingScience,UniversityHospitalGhent,Ghent, Belgium.

            Search terms:
            Attitude,patient aggression, predictor,
            psychiatric nursing, self-efficacy

            Author contact:
            veerle.duprez@ugent.be,witha copy to the
            Editor: gpearson@uchc.edu

            Conflict of Interest Statement
            Theauthorsdeclare that theyhaveno
            competing interests.

            Author Contributions
            SV,VD, andAVHconceivedanddeveloped the
            designof the study. SVand JL carriedout the
            data collection.VD,DB, andAVHcarriedout
            thedataanalyses. SV,VD, JL, andBVM
            contributed to the interpretationof thedata.
            All authors contributed indrafting the
            manuscript, and readandapproved thefinal
            version.

            *Bothauthors contributedequally to thiswork

            First Received June6,2014; Final Revision
            receivedOctober25,2014;Accepted for
            publicationNovember13,2014.

            doi: 10.1111/ppc.12097

            PURPOSE: To explore mental health nurses’ attitude and self-efficacy to adult inpa-
            tient aggression, and to explore the association with nurse-related characteristics.
            DESIGN AND METHOD: Cross-sectional study in a sample of 219 mental health
            nurses in nine psychiatric hospitals, with stepwise linear regression analysis to detect
            predictive models.
            FINDINGS: Female and less experienced nurses were less likely to blame patients
            for their behavior. Gender, burnout, secondary traumatic stress, and compassion
            satisfaction accounted for 26.2% of the variability in mental health nurses’ self-
            efficacy toward aggression.
            PRACTICE IMPLICATIONS: There needs to be attention to professional quality of
            life for mental health nurses, to provide them with of self-efficacy and a positive atti-
            tude toward coping with aggression.

            Healthcare professionals, and in particular mental health
            nurses, are regularly confronted with aggression (Foster,
            Bowers, & Nijman, 2007; Jansen, Dassen, Burgerhof, &
            Middel, 2006; Nijman et al., 1999; Rippon, 2000). For this
            study, aggression was broadly defined as “any verbal, nonver-
            bal or physical behaviour that was threatening (to self, others
            or property), or physical behaviour that actually did harm (to
            self, others or property)” (Morrison, 1990, p. 67). The preva-

            lence of aggressive incidents in psychiatric hospitals varies
            considerably across countries (Bowers et al., 2011). A review
            by Nijman, Palmstierna, Almvik, and Stolker (2005) revealed
            a mean of 9.3 incidents per patient per year for adults with
            mental illness, with a range of 0.4–33.2 incidents per patient
            per year. Severity ranged from 9.2 to 11.0 points on a scale of
            0–22 points, with higher scores indicating more severe
            aggression (Nijman et al., 2005). This variation in incidence

            Perspectives in Psychiatric Care ISSN 0031-5990

            Mental Health Nurses’ Attitudes and Perceived Self-Efficacy Toward Inpatient Aggression

            can partly be explained by differences in defining aggression
            and in registration methods, different care settings, and a
            decreased tendency to less threatening incidents
            (Bowers et al., 2011; Nijman et al., 2005). An aggression reg-
            istration study (n = 437) in psychiatric hospitals for adults in
            Belgium using the Staff Observation Aggression Scale-
            Revised (SOAS-R) (Nijman et al., 1999) revealed a mean of
            1.71 incidents per patient per year, with an average severity
            score of 9.69 (SD 5.04). A small group of patients (2%)
            appeared to be responsible for 50% of the incidents
            (Verhaeghe et al., 2011).

            Aggressive inpatient incidents have a multifactorial and
            complex nature (Abderhalden, Needham, & Dassen, 2008;
            Nijman et al., 1999). Occurrence of incidents, as well as their
            management, all reflects patient, ward, and staff variables in
            interaction (Abderhalden et al., 2008; Fluttert et al., 2008;
            Nijman et al., 1999; Nijman, de Kruyk, & Van
            Nieuwenhuizen, 2004).

            Conceptual Framework

            To gain insight into mental health nurses’ behavior toward
            aggressive patients, it is useful to understand the predictors of
            this behavior. The theory of planned behavior (TPB) provides
            a useful conceptual framework to accomplish this. According
            to the TPB, a person’s behavior is guided by his intentions,
            which refers to a person’s readiness to perform a given behav-
            ior (Fishbein & Ajzen, 2010). These intentions derive from
            attitudes, subjective norms, and self- efficacy (Azjen, 1988; De
            Vries, 1988) of the person (see Figure 1). Attitudes refer to a
            person’s evaluation of the behavior as more positive or nega-
            tive (Fishbein & Ajzen, 2010). Subjective norms encompass
            the influence of the judgments of others who are deemed
            important and the tendency to conform to that judgment
            (Fishbein & Ajzen, 2010). Self-efficacy or perceived behav-
            ioral control is the belief one has in his or her own ability to
            succeed in specific situations (Bandura, 1991; Fishbein &

            Ajzen, 2010). Two factors of the TPB—attitudes and self-
            efficacy—are included in this study because they fall within
            the control of the individual nurse to achieve a more positive
            attitude toward aggressive patients or a higher level of self-
            efficacy, thus likely contributing to a better working alliance
            with improved treatment outcomes (de Leeuw, Van Meijel,
            Grypdonck, & Kroon, 2012).

            Attitudes Toward Inpatient Aggression

            Attitudes toward aggression are comprised of three perspec-
            tives (Abderhalden, Needham, Friedli, Poelmans, & Dassen,
            2002; Bowers et al., 2011; Jansen, Middel, & Dassen, 2005;
            Jansen, Dassen, et al., 2006). First, aggression is perceived as a
            dysfunctional phenomenon that is violent, offensive, destruc-
            tive, intrusive, or harmful; second, aggression can also be per-
            ceived as a functional, instrumental, or communicative
            phenomenon, a feeling expressed to meet a particular need;
            and third, aggressive behavior can be interpreted as a normal
            or protective phenomenon, where aggression is an acceptable
            reaction to feelings of anger. The last two perspectives are
            highly interlinked and related to a more tolerant, permissive
            attitude toward aggression (Jansen, Middel, & Dassen, 2005).
            Research reveals that most often, mental health nurses view
            aggression as a harmful, offensive, and destructive behavior
            on the part of the patient (Finnema, Dassen, & Halfens, 2004;
            Jansen, Middel, Dassen, & Reijneveld, 2006; Jonker,
            Goossens, Steenhuis, & Oud, 2008). Few of them emphasize
            the positive, protective nature of aggression (Jansen, Middel,
            et al., 2006; Jonker et al., 2008). It is assumed that mental
            health nurses with more tolerant, permissive, and positive
            attitudes may have better clinical skills to respond to incidents
            of aggression. This statement is supported in different health-
            care domains, demonstrating the impact of positive attitudes
            on the quality of nursing practice, for instance, in the applica-
            tion of adequate pressure ulcer prevention (Beeckman,
            Defloor, Schoonhoven, & Vanderwee, 2011). The capacity to

            Figure 1. ConceptualModel of theStudyBasedon theTheoryof PlannedBehavior

            13Perspectives in Psychiatric Care 52 (2016) 12–24
            © 2014 Wiley Periodicals, Inc.

            Mental Health Nurses’ Attitudes and Perceived Self-Efficacy Toward Inpatient Aggression

            see aggression in a more positive perspective is reflected in the
            use of fewer coercive measures (Jonker et al., 2008) and con-
            tributes to a better working alliance with improved treatment
            outcomes (de Leeuw et al., 2012).

            Perceived Self-Efficacy

            Based on Bandura’s (1991) theory of self-efficacy, it is
            assumed that the perceived level of self-efficacy toward
            aggression will influence nurses’ actual reaction to and behav-
            ior toward aggressive incidents. This assumption is exten-
            sively supported in research on the self-management
            behavior of persons with chronic illness (Bonsaksen, Lerdal,
            & Fagermoen, 2012; Marks, Allegrante, & Lorig, 2005) and in
            research on nursing competencies and perceived skills
            (Nørgaard, Ammentorp, Ohm Kyvik, & Kofoed, 2012; Van
            Hecke, Grypdonck, Beele, De Bacquer, & Defloor, 2009). A
            mental health nurse who perceives that he/she has a low self-
            efficacy is more likely to see a potential violent situation as
            dangerous and threatening, and thus may react in a
            nontherapeutic way. Alternatively, perceived high self-
            efficacy in dealing with aggression, with the corresponding
            feelings of security and self-confidence, is an important con-
            dition for therapeutic interactions between patients and
            mental health nurses (Dunn, Elsom, & Cross, 2007; Lowe,
            Wellman, & Taylor, 2003; Martin & Daffern, 2006; Totman,
            Hundt, Wearn, Paul, & Johnson, 2011).

            Considered within the context of the conceptual frame-
            work, attitudes and self-efficacy of mental health nurses
            toward aggressive behavior are in turn influenced by nurse-
            related characteristics (Azjen, 1988) (see Figure 1). Studies
            have provided contradictory findings about the influence of
            nurse-related characteristics on attitudes toward aggression.
            Some studies that nurses who have had less contact
            with aggressive patients because of part-time schedules or
            fewer years of work experience, tend to have a more positive
            attitude toward aggressive incidents (Jansen, Dassen, et al.,
            2006; Jansen, Middel, et al., 2006; Palmstierna & Barredal,
            2006). This is in contrast with the study by Whittington
            (2002), which demonstrated that tolerance for aggression is
            higher among more experienced nurses (more than 15 years).
            Furthermore, the study of Jansen, Middel, et al. (2006)
            revealed that female nurses agreed more than their male col-
            leagues that aggression is a destructive phenomenon, in con-
            trast to the opposite results of Palmstierna and Barredal
            (2006). The study by Abderhalden et al. (2002) found no rela-
            tionship between the perception of aggression and staff char-
            acteristics. These previous studies focused on identification of
            the appraisal and tolerance toward aggressive incidents. They
            did not provide information on other interesting aspects of
            attitudes toward aggressive incidents, such as the belief in pre-
            dictability of incidents, feelings of security or anxiety, feelings
            of competence in managing violent behavior, confidence in

            dealing with aggressive incidents, and possible association
            with nurse-related characteristics. These aspects of attitudes
            can provide useful information for hospital managers and
            staff in evaluating and improving aggression management
            programs and policies.

            Research on the association between mental health nurses’
            perceived level of self-efficacy in managing inpatient aggres-
            sion and nurse-related characteristics is limited, and was
            conducted within a mixed population of mental health pro-
            fessionals, including just a small sample of mental health
            nurses (Lowe et al., 2003; Martin & Daffern, 2006; Totman
            et al., 2011).

            Since aggressive incidents and verbal threats are linked with
            anxiety, symptoms of post-traumatic stress disorder, and
            symptoms of burnout (Gascon et al., 2013; Whittington,
            2002), they can cause an internal value conflict (Winstanley &
            Whittington, 2004). This might affect nurses’ attitudes and
            self-efficacy toward aggressive patients and incidents. To date,
            it is not clear if an association exists between mental health
            nurses’ perceived professional quality of life and attitude or
            self-efficacy toward inpatient aggression. This study included
            perceived professional quality of life as a nurse-related
            characteristic.

            We may conclude that studies have provided contradictory
            or limited findings about the influence of nurse-related char-
            acteristics on attitude and self-efficacy toward aggression. To
            eliminate this gap, this study aimed to explore mental health
            nurses’ attitudes and perceived self-efficacy toward inpatient
            aggression in adult psychiatric hospitals. The second aim was
            to explore the associations between attitudes and perceived
            self-efficacy toward aggression and nurse-related characteris-
            tics. The nurse-related characteristics under study are per-
            ceived professional quality of life, age, gender, educational
            degree, degree in psychiatric nursing, and length of work
            experience. A comprehensive exploration of mental health
            nurses’ attitudes and perceived self-efficacy, and their associa-
            tion with nurse-related characteristics, including the per-
            ceived professional quality of life, is important to develop
            tailored interventions to support mental health nurses in
            managing aggression.

            Methods

            Setting and Sample

            This study focused on mental health nurses working in psy-
            chiatric hospitals. The selection of participants was per-
            formed in two phases. In phase 1, the Belgian Federal Public
            Service of Health Care emailed all psychiatric hospitals for
            adults (N = 63) in Belgium to invite them to participate in an
            implementation study on aggression management. Nine psy-
            chiatric hospitals agreed to participate. In phase 2, a purpo-
            sive sample of wards from the nine participating hospitals was

            14 Perspectives in Psychiatric Care 52 (2016) 12–24
            © 2014 Wiley Periodicals, Inc.

            Mental Health Nurses’ Attitudes and Perceived Self-Efficacy Toward Inpatient Aggression

            drawn. A minimum of one and maximum of three wards,
            where frequent incidents of aggression were reported by
            nursing directors, were selected from each hospital. To maxi-
            mize the representativeness of the sample, wards were
            selected for differentiation, such as type of wards (acute
            admission vs. chronic care wards), psychopathology (depres-
            sion, psychosis, or addiction care), and number of beds
            (ranging from small residential groups to wards with 50
            beds). Psychiatric wards for forensic care were excluded. The
            final selection of wards was made in consultation with the
            nursing directors of the participating hospitals, taking into
            account organizational elements, such as prolonged absences
            of staff members, or other implementation processes that
            were occurring on the ward. A total of 17 wards participated.
            All nurses (N = 219) working on the included wards were
            invited to participate in the study.

            Data Collection

            Data were collected through self-administered question-
            naires completed by the nursing staff on the participating
            wards between November and December 2011. The question-
            naires consisted of the Attitude Toward Aggressive Behavior
            Questionnaire (ATABQ) (Collins, 1994) for measuring atti-
            tude, the Confidence in Coping With Patient Aggression
            Instrument (CCPAI) (Thackrey, 1987) for self-efficacy, the
            Professional Quality of Life Questionnaire (ProQoL)
            (Stamm, 2010) for professional quality of life, and a record of
            demographic data including age, gender, educational degree,
            education in psychiatric nursing, years of work experience in
            psychiatric care, and years of work experience on the ward.
            During a staff meeting, the research team informed the nurses
            of the participating wards about the purpose and procedures
            of the study. The nurses were asked to complete the question-
            naires individually during this staff meeting. Two occasions
            were selected to provide all nurses the opportunity to partici-
            pate in the study. All eligible nurses from the selected wards
            participated in the study.

            Instruments

            Attitude. Most instruments to measure attitudes toward
            aggression focus on the identification of the appraisal and
            tolerance toward aggressive incidents (Duxbury, Hahn,
            Needham, & Pulsford, 2008; Jansen, Dassen, et al., 2006;
            Whittington, 2002). This study was designed to investigate the
            broad range of aspects related to nurses’ attitudes toward
            aggression, broader than the appraisal of aggressive incidents.
            The ATABQ developed by Collins (1994) provided such a
            broad range of aspects, which are reflected in its subscales. The
            12 statements on aggressive behavior of patients are divided
            into five subscales: patient responsibility for aggression, staff
            safety, predictability of incidents, competence in managing

            violent behavior, and confidence of staff in dealing with
            aggressive incidents. Items are scored on a 5-point Likert scale
            from 1 (strongly disagree) to 5 (strongly agree). Scores ranged
            from 1 to 5 at subscale level and from 12 to 60 at scale level, with
            a higher score indicating a more positive attitude. The lack of
            reference scores and cutoff points allowed only the interpreta-
            tion of a mean score in relation to the mean score of another
            group. The ATABQ test–retest reliability is 0.97 (Collins,
            1994).

            Self-Efficacy. The CCPAI developed by Thackrey (1987) has
            the capacity to monitor perceived self-efficacy toward aggres-
            sion in a comprehensive and one-dimensional way. It was
            developed for use in mental healthcare settings (Thackrey,
            1987). The instrument includes 10 statements, scored on an
            11-point Likert scale, ranging from 1 (very uncomfortable) to
            11 (very comfortable). Scores ranged from 10 to 110, with a
            higher score indicating a higher level of self-efficacy toward
            inpatient aggression. The CCPAI lacks cutoff scores, so a
            mean score can only be interpreted in relation to the mean
            score of another group. Previous studies with the CCPAI
            showed an internal consistency of α = .88 (Thackrey, 1987)
            and α = .92 (Allen & Tynan, 2000).

            Professional Quality of Life. The ProQoL was used to measure
            the professional quality of life. The ProQoL assesses general
            job satisfaction (Stamm, 2010). It can be adapted to any pro-
            fession that chooses to help others (Stamm, 2010). The
            instrument includes 30 statements divided into three
            subscales: compassion satisfaction, burnout, and secondary
            traumatic stress (Stamm, 2010). Compassion satisfaction is
            referring to the pleasure one derives from being able to do his
            work. Burnout is referring to feelings of hopelessness and dif-
            ficulties in dealing with work or doing the job effectively. Sec-
            ondary traumatic stress is a negative feeling driven by fear and
            work-related trauma. The statements are scored on a 5-point
            Likert scale. The ProQoL has good internal consistency for its
            subscales: compassion satisfaction (α = .88), burnout
            (α = .75), and secondary traumatic stress (α = .81) (Stamm,
            2010). The ProQoL was already used in research on the job
            satisfaction of mental health nurses (Lauvrud, Nonstad, &
            Palmstierna, 2009; Newell & MacNeil, 2011).

            The set of instruments was translated into Dutch and
            French by a back-forward translation procedure with mono-
            lingual testing. A two-round Delphi procedure with profes-
            sional translators and healthcare professionals was used for
            the forward translation. In order to assess comprehensive-
            ness, the translated instruments were presented to a group of
            seven mental healthcare nurses and seven researchers during
            individual interviews. These interviews resulted in only
            minor changes to optimize the comprehensibility of the
            translated questionnaires. The professional translators con-
            ducted a backward translation for verification. No further

            15Perspectives in Psychiatric Care 52 (2016) 12–24
            © 2014 Wiley Periodicals, Inc.

            Mental Health Nurses’ Attitudes and Perceived Self-Efficacy Toward Inpatient Aggression

            comments were provided. The internal consistency reliability
            of the translated instruments was assessed and is presented in
            Table 1.

            Ethical Considerations

            This study was approved by the Ethical Review Committee of
            Ghent University Hospital and by the local committees of the
            participating hospitals (No. B67020109275). All participants
            were given detailed information (written and verbal) about
            the study and signed an informed consent.

            Data Analysis

            SPSS v21 (SPSS Inc., Chicago, IL, USA) was used for all statisti-
            cal analyses. A significance level of .05 was used. Descriptive
            statistics (counts, percentages, means, and standard deviation)
            were calculated. The data were verified for normality of distri-
            bution and equality of variances. With respect to group com-
            parisons, independent Student’s t tests or one-way analysis of
            variance (ANOVA) was used. To avoid type I errors, compari-
            son of four groups was conducted using an adjusted alpha level
            of .0125. Pearson’s correlation coefficients were calculated to
            measure the strength of associations between the outcomes
            under measure (attitude and self-efficacy) and the nurse-
            related characteristics at scale level (age, work experience, and
            professional quality of life). To explore associations between
            nurse-related characteristics, attitudes, and perceived self-
            efficacy levels toward patient aggression, a forward stepwise
            linear regression analysis was performed. Associated factors
            with a significance value of less than or equal to .05 were
            included in the model. In the second phase, a backward regres-
            sion analysis was performed to verify the results of forward
            regression analysis. The backward regression analyses crite-
            rion to remove the predictor was held at F greater than or equal
            to .100. The models were checked for multi-collinearity.

            Results

            Sample Characteristics

            A total of 219 nurses participated in this study. The mean age
            of the participants was 41.23 (SD 11.43) years and 72.6% were
            female. The sample consisted of 53.9% nurses with a bachelor

            of science degree. A degree in psychiatric nursing was
            obtained by 79.4% of the participating nurses. This degree at
            bachelor and diploma level is obtained by following optional
            courses within the regular nursing curriculum. Almost 54%
            of the nurses had 10 or more years of work experience in psy-
            chiatric care, and 26.5% had worked 10 years or longer on the
            participating ward. An overview of the general characteristics
            of the sample is presented in Table 2.

            Attitude Toward Inpatient Aggression

            The mean score on the ATABQ was 37.36 (SD 3.79). Group
            comparisons for the total ATABQ score revealed no

            Table 1. InternalConsistencyTranslated
            Questionnaires

            Questionnaire
            Dutch version
            Cronbach’s α

            French version
            Cronbach’s α

            Attitude (ATABQ) .35 .52
            Self-efficacy (CCPAI) .91 .90
            Professional quality of life (ProQoL) .56 .52

            ATABQ, Attitude Toward Aggressive Behavior Questionnaire; CCPAI, Confidence in Coping With
            PatientAggression Instrument; ProQoL, ProfessionalQuality of LifeQuestionnaire.

            Table 2. GeneralCharacteristics of Sample

            Characteristics (n = 219) N (%)

            Gender
            Female 159 (72.6)
            Male 52 (23.7)
            Missing 8 (3.7)

            Age (years)
            21–30 52 (23.7)
            31–40 51 (23.3)
            41–50 51 (23.3)
            >50 63 (28.8)
            Missing 2 (.9)

            Workexperience inpsychiatry (years)
            <1 18 (8.2)
            1–5 41 (18.7)
            6–10 42 (19.2)
            >10 118 (53.9)
            Missing 0 (.00)

            Workexperienceonward (years)
            <1 44 (20.1)
            1–5 64 (29.2)
            6–10 52 (23.7)
            >10 58 (26.5)
            Missing 1 (.50)

            Educational degree
            Diploma levela 96 (43.8)
            Bachelorof sciencedegree 118 (53.9)
            Missing 5 (2.3)

            Degree inpsychiatric nursing
            Yes 174 (79.4)
            No 40 (18.3)
            Missing 5 (2.3)

            aDiploma level is a3-yearnurse trainingeducationatqualification level 5
            of theEuropeanHigher EducationArea.

            16 Perspectives in Psychiatric Care 52 (2016) 12–24
            © 2014 Wiley Periodicals, Inc.

            Mental Health Nurses’ Attitudes and Perceived Self-Efficacy Toward Inpatient Aggression

            significant differences for the nurse-related characteristics
            under study (see Table 3). It demonstrated only weak correla-
            tions with compassion satisfaction (r = .143, p < .05) and
            burnout (r = −.149, p < .05) (see Table 4). None of the nurse-
            related characteristics were retained in the regression analysis
            (see Table 5).

            Associations with nurse-related characteristics were found
            at subscale level (see Tables 3 and 4). The subscale “predic-
            tion” revealed a mean score of 3.85 (SD .59). A weak negative
            correlation was found between this aspect of attitude toward
            patient aggression and age (r = −.178, p < .05) (see Table 4).
            The factor age was included in the regression analysis. The
            model had a predictive value of less than 10% (see Table 5).

            The subscale “attribution and responsibility” revealed a
            mean score of 3.31 (SD .48). Group comparisons demon-
            strated significant differences for gender (see Table 3). Female
            nurses had statistically significantly higher scores on ques-
            tions regarding patient attribution and responsibility for
            aggressive incidents than male nurses (3.35 vs. 3.18,
            t = −2.203, df = 205, p = .029). Higher scores refer to a lower
            tendency to place blame and thus a more tolerant perspective
            on aggression. Negative correlations (see Table 4) were found
            between attribution and responsibility for aggressive inci-
            dents on the one hand, and the years of work experience in
            psychiatric care (r = −.166, p < .05), the years of experience on
            the ward (r = −.155, p < .05), and level of burnout (r = −.148,
            p < .05) on the other hand. The mentioned significant or cor-
            related factors were included in the regression analysis. The
            model had a predictive value of less than 10% (see Table 5).

            The subscale “staff anxiety and fear of assault” revealed a
            mean score of 3.93 (SD .62). Higher scores refer to the belief
            that aggression is part of working in psychiatric care. Signifi-
            cant group differences were demonstrated for post-traumatic
            stress levels (F = 4.569, df = 2, p = .012) (see Table 3). Mental
            health nurses in the categories low and moderate post-
            traumatic stress level considered aggression more as a part of
            the job. This subscale revealed no significant correlations (see
            Table 4). None of the nurse-related characteristics were
            retained in the regression analysis (see Table 5).

            The mean score on the subscale “need skilled intervention”
            was 4.18 (SD .45). Higher scores referred to a higher belief in
            the importance and need for training and for skills to prevent
            and manage aggression. Group comparisons demonstrated
            significant differences for degree in psychiatric nursing and
            borderline significance with gender (see Table 3). Nurses who
            did not have a degree in psychiatric nursing revealed a signifi-
            cantly higher need for specific training and skills to prevent
            and manage aggressive behavior compared to nurses with a
            degree in psychiatric nursing (4.36 vs. 4.14, t = 2.729, df = 211,
            p = .007). Male nurses reported a higher need for intervention
            training to prevent and manage aggression than their female
            colleagues (4.25 vs. 4.14, t = 1.901, df = 208, p = .059). A low
            positive correlation was found with compassion satisfaction

            (r = .156, p < .05) (see Table 4). The mentioned significant or
            correlated factors were included in the regression analysis. The
            model had a predictive value of less than 10% (see Table 5).

            The mean score on the subscale “staff confidence” was 3.76
            (SD .67). Group comparisons within this subscale demon-
            strated significant difference for gender and compassion sat-
            isfaction (see Table 3). Male mental health nurses had
            statistically significantly higher scores on the subscale of con-
            fidence in the ability to deal with and having control over
            patients with aggression (4.00 vs. 3.68, t = 3.111, df = 101, p =
            .001). Mental health nurses with a high or moderate level of
            compassion satisfaction had a statistically significantly higher
            score on this subscale (F = 10.878, df = 2, p = .000). It demon-
            strated a positive correlation with compassion satisfaction
            (r = .307, p < .01) and a negative correlation with secondary
            traumatic stress (r = −.192, p < .01) (see Table 4). The men-
            tioned significant or correlated factors were included in the
            regression analysis. Staff confidence in dealing with aggres-
            sion has two predictors: gender and compassion satisfaction.
            These two factors explained 14.4% of the variance in staff
            confidence in dealing with aggressive incidents (see Table 5).

            Perceived Self-Efficacy

            The mean score on the CCPAI was 61.44 (SD 14.57). Group
            comparisons revealed statistically significant differences for
            gender and compassion …

            RESEARCH

             

            Discussion #2: Qualitative Research

            Read the posted article.

            **Refer to this week’s assigned textbook readings for support.** 

            Respond  to the questions below by reviewing the article and identifying those  elements (state the page number you found the element). As you discuss  the researcher’s use of the element, make sure your discussion is  properly supported by  your textbook.

            Your critique responses should reflect upon the following:
            1. What type of qualitative approach did the researcher use? Provide a definition of the type of approach. 
            2. What type of sampling method did the researcher use? Is it appropriate for the study? Why or why not?
            3. Discuss whether the data collection focused on human experiences.
            4. How did the author address the protection of human subjects?
            5. How did the researcher describe data saturation?
            6. What procedure for collecting data did the researcher use?
            7. Describe the strategies the researcher used to analyze the data.
            8. How did the researcher address the following:

            • Credibility 
            • Auditability 
            • Fittingness 

            9. What is your cosmic question? (This is a question you ask your peers to respond to based on this week’s topic of Qualitative Research).

            FYI: PLEASE NOTE THAT REFERENCES ARE IMPORTANT IN ALL MY ASSIGNMENT AND I WILL PROVIDE YOU WITH MY RESEARCH TEXTBOOK DETAILS

            www.redshelf.com

            username is doloyede1503@mymail.stratford.edu

            password: Goodnews22

            • 10

            RESEARCH

             

            1. Minimizing bias and decreasing threats to internal validity is  important to experimental designs. Explain how a researcher uses  manipulation, randomization, and control to minimize bias and decrease  threats to internal validity.

            2. Many times, researchers state  that randomized control trials (RCT) provide the strongest level of  evidence for an individual study. As a consumer of research, do you think this statement is true? Why or why not?

            3.  When conducting an experimental study, discuss how the researcher will  use intervention fidelity to increase the strength and quality of the  evidence provided by the findings of the study.

            4. What is your Cosmic Question? (This is a question you will ask your peers to respond to based on the this week’s topic of Quantitative Research.)

              • 10

              RESEARCH

               

              Submit PICO(T) Question

              Submit your PICO(T) clinical question. See grading rubric in Syllabus Supplement and sample PICOT for guidance.

              PICOT/The Research Question 

              The student will reflect on clinical nursing practice and write a research question. The question will be developed by using the PICOT framework (Population, Intervention, Comparison, Outcome, Time). The student will identify a nursing clinical question as follows:

              ·        What individual or group am I curious about? (population)

              ·        What key intervention am I curious about? (intervention) 

              ·        What intervention will I be comparing? (comparison) 

              ·        What do I hope to accomplish, or What would happen if I did this? (outcome)

              ·        How much time will the intervention take to achieve the desired effects? (time)

              The aim of the PICOT is to discover current research and promote best practices. The PICOT will guide the Literature Review. The PICOT must have a nursing clinical focus. A rationale for each element of the PICOT question must be provided and supported by a credible source. List the references on the reference page, following APA format.

              Students will be able to resubmit the PICOT assignment one time.

              research

               Discuss the differences between experimental and correlational research and why one was more adequate for the study. Describe the study following the steps of the scientific process. Which are the independent variable(s) and dependent variable(s)? What else needs to be controlled for and how? Who is recruited and why? What are the strengths and limitations of the study based on its design? 

               

                • 20

                Research

                Comparing and
                Contrasting:

                Research, H amlet,
                and our course themes

                Essay #4
                Assignment Due: December 20
                11:59 PM to Canvas/TurnItIn

                For your fourth writing assignment you will write a thesis-based argument in which you will
                compare and/or contrast the use of our course themes in Hamlet with themes in our other course
                text(s). The prompt requires that you conduct significant outside research of scholarly
                secondary sources, and incorporate that research into your argument.
                To successfully write this essay, complete the following steps:

                a.) Select one of the themes that we have been tracking this semester (Friendship/Love,
                Revenge/Repair, Ghosts, Truth, Memory, Nature, and Narrative Technique).

                b.) Conduct scholarly research on your selected theme.
                c.) Select ONE or TWO other text(s) that we have examined this semester, in addition to

                Hamlet. The only combination that is NOT allowed is Hamlet, The Buried Giant, and
                Wuthering Heights.

                d.) Write an essay in which you compare and/or contrast the use of your selected theme
                within Hamlet and the other course text(s) you have selected by synthesizing
                information from the play, the other literary text(s), and your scholarly research.
                You MUST apply the research to specific characters, relationships, and/or moments.

                Remember that the keys to a successful essay will be:
                a. Articulating a clear, precise thesis statement (that contains a WHAT, WHY, and HOW).
                b. Presenting a portion of your thesis argument in clear, precise topic sentences (all of

                which must contain WHAT and WHY statements).
                c. Providing evidence to support that thesis statement in the form of quotations from the

                play, one or two other course text(s), and from at least two scholarly secondary sources
                from your own research. You must quote from Hamlet, your other course text, and
                your research in EVERY body paragraph!

                d. Connecting the evidence to your thesis and/or topic sentence by way of your own
                analysis, which must be an explanation of HOW the quotation you have chosen
                supports your primary argument.

                e. Concluding by articulating the lesson of your thesis statement and demonstrating what’s
                at stake for your argument (the SO WHAT?).

                f. Ensuring that the essay conforms to MLA standard formatting/grammar.

                The Format:
                You must compose your essay using Google Course Kit (see Canvas for more details). Your
                final draft must be 7-10 complete double-spaced pages with 1-inch margins in 12-point, Times
                New Roman font. Be sure to use MLA format for your in-text citations and your works cited
                page. Refer to the syllabus for the late paper policy. When you submit your final draft to
                Canvas/TurnItIn, please ensure that it is in PDF format.

                RESEARCH

                  

                PICOT Rubric PICOT Weight Present Absent Patient/Population (add rationale with reference) Required Intervention (add rationale with reference) Required Comparison (add rationale with reference) Required Outcome (add rationale with reference) Required Timing (add rationale with reference) Optional Total: (100% possible) PICOT demonstrates applicability to nursing profession PICOT will be returned if not nursing-related Submitted by deadline .

                • 15

                RESEARCH

                   Select 5 primary research articles published in peer reviewed journals. These should be the articles that you have obtained from your literature search. Write a simple sentence for each article to demonstrate your knowledge of formatting in-text citations using APA guidelines. Then provide an APA-formatted reference list for the 5 articles. 

                           

                                              GRADING RUBRIC

                       APA Assignment grading Rubric APA Assignment grading Rubric % Total 5 in-text citations formatted using current APA guidelines 10% for each correctly cited in-text citation 50% Reference list of 5 articles formatted using current APA guidelines 10% for each correctly cited reference list 50% Grand total 100% 

                • 14

                RESEARCH

                 

                Select 5 primary research articles published in peer reviewed journals. These should be the articles that  you have obtained from your literature search. Write a simple sentence  for each article to demonstrate your knowledge of formatting in-text citations using APA  guidelines. Then provide an APA-formatted reference list for the 5 articles.

                See Sample in Moodle.

                See Syllabus Supplement for Grading Rubric.

                **No late submissions or resubmissions will be allowed. Do your best work the first time.** 

                RESOURCES

                 LoBiondo-Wood, G., & Haber, J. (2022). Nursing research: Methods and  critical appraisal for evidence-based practice. Elsevier. 

                • a month ago
                • 6

                Research

                Using the attached documents, please answer all questions and all parts. Thank you, 

                Assignment:  

                The major purpose of this assignment is to write about the statistical findings in a professional way. You may use parent or teacher ratings in your write-up. Using the output provided, address the hypotheses stated in the Research Questions:

                1. Are baseline (Fall) ratings of children selected for the playgroup intervention (‘at risk’) lower in protective factors and skills and higher in behavioral challenges than those not selected (‘not at risk’)?
                2. Do children who received the playgroup intervention have lower challenge ratings (BC, DISR, DISC) in the spring than in the fall? 
                3. Do children who received the playgroup intervention have higher protector factors and skills ratings (PINT, IN, AT, SC) in the spring than in the fall?

                Your write-up will include four sections, written in paragraph form.  

                1. Participants: (not a full section, just the demongraphics)

                Using the information provided in the overview, describe the source and size of the original sample. From the output, provide descriptive statistics for age (mean, sd, n) by gender and risk status for the sample used for the analyses.  

                1. Data Analysis:  

                Describe the program used (SPSS) and the types of analyses (independent and dependent samples t tests).

                1. Results: (multiple paragraphs)

                State the hypotheses that were tested, the results, and the findings in publication format. Review publication format for these analyses. The results in your output may not be the same as described here.

                For example: “To confirm the premise that children selected for playgroup have more challenges and lower levels of protective factors and skills, independent samples t tests (two-tailed, α=.05) were used to compare the ratings of ‘at risk’ children with those ‘not at risk’. As expected, a significant difference at baseline between these two groups were found for teacher ratings of initiative, self-control, attachment, play interaction, behavioral concerns, and play disconnection….Contrary to expectations, baseline play disruption did not differ between at risk and not at risk children.”  

                Make sure to respond to all three sets of hypotheses.  

                1. Interpretation/Discussion

                Summarize the findings by consideration of all the results in the larger context of the study. For example, you might start (if this is true in the output provided): “In considering these analyses from the 3rd year of the project, it can be seen that most of the research questions have been answered in the affirmative: Overall, at risk children showed lower average fall ratings by their teachers in protective factors than their not at risk peers. In addition, they were rated as having higher levels of behavioral concerns and play disconnection, but not of play disruption.” Etc.

                • a month ago
                • 15

                Research

                Based on the links below

                 what do you think is the best way that articles in psychology should be selected for publication? What are the key strengths of your suggested method? The weaknesses? 

                  Library Article: Peer Review in Scientific Publications: Benefits, Critiques, & A Survival Guide

                 Library Article: Benefits of Peer Review on Students’ Writing
                Library Article: Giving Feedback: Preparing Students for Peer Review and Self-Evaluation. 

                  • 10

                  Research

                  The BIG TEN: Do’s and Most Definitely Absolutely DO Not Ever’s to Writing Your Ultimate
                  Government and Political Science Papers

                  Things that are important for any political science research paper:

                  • Always make sure that opposite opinion or counter argument paragraph is included before
                  conclusion part.

                  • Backup provided facts with reliable academic sources.
                  • Turn to statistics & data to support provided ideas.
                  • Research related literature & similar projects.
                  • Adhere to one idea – one paragraph rule.

                  Things that you should avoid while completing a research paper for political science class:

                  • Addressing sensitive subjects, do not use harsh tone.
                  • Unless working with personal reflection, avoid portrayal of only one side of an issue.
                  • Stay neutral when talking of political parties. In such way, it allows seeing benefits & flaws

                  of each actor on his or her own.
                  • Do not use extensive quoting unless absolutely necessary.
                  • Avoid colloquial language along with slang term elements.

                  Formatting the Structure and Organization of Your Political Science Paper

                  Is the political science research paper format special? It is quite similar to other tasks, so you
                  may use the following structure:

                  • The first part of your text is the introduction – in this part, you need to explain your
                  choice of the theme and name the aims of your working process. Do not forget to include
                  the methods you have used during your work;

                  • Then, you have to express your ideas in the main body of the work;
                  • After all segments of your work are ready, you may have a question “how to conclude an

                  essay?”. It should include all the results of your research and its main ideas in short. Do
                  not forget that the professors may ask you some questions regarding your research;
                  therefore, you need to reread your work before a presentation to know everything about
                  it.

                  • The BIG TEN: Do’s and Most Definitely Absolutely DO Not Ever’s to Writing Your Ultimate Government and Political Science Papers
                  • Formatting the Structure and Organization of Your Political Science Paper

                  Research

                   Research and construct a 3–5 page research excluding title and reference pages) on the current income tax structure in the United States. In addition, research at least one other structure and compare the two structures. should have a minimum of three scholarly sources and be formatted according to APA guidelines. 

                  RESEARCH

                  Stratford University School of Nursing
                  Syllabus Supplement

                  1

                  Course: NSG 410, Research and Evidence-Based Nursing Practice

                  Term: 01, 2022

                  Faculty: Dr. Coffin

                  School of Nursing Standard Course Information:

                  1. Understand and follow all Stratford University and School of Nursing policies and procedures
                  as identified in the Stratford Catalog and the School of Nursing Student Handbook.

                  2. Students are expected to do their own work on exams, quizzes, and individual assignments.

                  When an assignment or homework is completed within a group process, the faculty will clearly
                  indicate it.

                  3. All assignments have a due date and time posted, and it is the student’s responsibility to know

                  when the assignment is due. If the student has a problem with accessing or turning in an
                  assignment due to Moodle/computer/technology issues, email the instructor so the problem can
                  be addressed.

                  4. All assignments/homework must be submitted via Moodle, not via email, by the due date to

                  receive full credit. If there is an extenuating circumstance and the student is not able to submit
                  the work by the due date, the student must contact the instructor prior to the due date.

                  5. Unless otherwise identified by the course faculty, all assignments submitted shall be submitted

                  as a “final” copy. Do not submit assignments as a draft.

                  6. The School of Nursing requires written work to comply with the most current APA standards
                  and formatting and comply with the Academic Integrity standards of Stratford University.
                  References and citations are expected when material submitted is not the student’s original
                  work (i.e., definitions, evidence-based practices, interventions, lists, descriptions, etc.).
                  Students are encouraged to use plagiarism websites to review for plagiarism as needed. A good
                  resource for APA formatting is https://owl.purdue.edu

                  7. Students must achieve a minimum grade of 80% (B-) to pass a Nursing course. When a course
                  has a clinical or lab component (pass/fail), the student must pass that component to pass the
                  course. Students passing the theory but failing the clinical/lab will earn an overall grade of not
                  more than C+.

                  8. Course assignments and homework are identified in the table below along with the topic

                  outline. Detailed directions and rubrics for assignments and homework are found in the
                  Important Documents area of the Moodle site for the course. Students are responsible for
                  following the directions and meeting the requirements of the assignments, homework, and
                  rubric(s).

                  The Syllabus Supplement contains additional information to the E-Syllabus for this course. The
                  contents of the Syllabus Supplement are an extension of the E-Syllabus for the course, and therefore,
                  are viewed as part of the official contract and requirements for the course. Students are responsible for
                  all information in the E-syllabus, the Syllabus Supplement, and all guides, rubrics, assignment
                  directions, etc., posted on the Moodle site.

                  Stratford University School of Nursing
                  Syllabus Supplement

                  2

                  9. Read your Stratford email daily. All official course communication will be done via Stratford

                  email and/or the course Moodle site.

                  10. Some Nursing courses require completion of a practice and/or proctored assessments via a
                  product called ATI. Specific requirements for each course are identified in a separate
                  document. The student is responsible for completing all ATI requirements for the course.

                  11. Some courses include a simulation learning activity. Guidelines and learning outcomes for

                  each simulation are provided to the student.

                  12. Tests/exams and quizzes are given on the date and at the time listed for the course.
                  a. Students are expected to be in their seats and ready to begin class at the appointed time.
                  b. Exams will be the first item of class business and will start no later than 5 minutes after

                  the published class start time.
                  c. Students who arrive to class after the exam has been distributed, and the instructor has

                  announced that the exam has begun may not be allowed into the classroom as this
                  disrupts other students.

                  d. The student may be allowed to take the test elsewhere provided there is a room and a
                  proctor available and will be expected to return to class at the time appointed to resume
                  class after the exam is completed.

                  e. Students who arrive more than 30 minutes late for class will have the option of taking
                  the test but within a shortened time frame as they will be expected to return to class at
                  the time appointed for resuming class after the exam is completed.

                  f. In the event a student is cognizant of a situation that will prohibit the student from
                  attending class (i.e., hospitalization, emergency, etc.) the student is responsible to and
                  must contact the instructor prior to the exam to schedule a time to take the exam.

                  g. Students who miss the exam due to an approved absence or documented emergency
                  may be required to submit evidence supporting these claims within 5 workdays of the
                  exam date. If the claims are verified, the students will be allowed to make up the exam
                  without a point penalty. Students are allowed one make-up exam per term. The make-up
                  must be completed within 5 workdays from the absence including the day of absence.

                  h. Students who miss an exam due to an unexcused absence, undocumented emergency or
                  tardiness will receive a zero without an opportunity to the make-up exam.

                  i. All students will bring personal items to the front of the classroom. Cell phones will be
                  turned off, and students may be required to place the phone on the front table during all
                  exams.

                  13. Stratford University School of Nursing uses remote proctoring software to support on-line
                  test security. It is a requirement for all students enrolled in any course that begins with the
                  prefix NSG to have the following computer support available:

                  a. Students are required to allow electronic or web-based monitoring for exams and / or
                  quizzes. It may be a requirement to turn your camera on for the proctoring period (or
                  use a lock down browser). Failure to permit either of these types of monitoring

                  Stratford University School of Nursing
                  Syllabus Supplement

                  3

                  modalities will result in a “0” grade for the exam. This is considered an academic
                  integrity violation.

                  b. Desktop or laptop computer (no iPads, tablets) with the ability to download Google
                  Chrome

                  c. Google Chrome: version 80 or higher
                  d. PC: version Windows 10 or later; Min resolution 1024 x 600
                  e. Mac-version: Mac OS® X 10.13 or later; Min resolution 1024 x 600
                  f. Internet speed: The internet speed required is 0.092 – 0.244 Mbps. Internet speed can

                  be tested by using w w w . sp e e dt es t . ne t
                  g. Microphone: Any microphone, either internal or external
                  h. Webcam: 320×240 VGA resolution (minimum) internal or external

                  General School of Nursing Classroom Policies

                  1. Cell phones are a disruption to learning even in the ‘vibrate’ mode. Cell phones must be turned

                  off during class.
                  2. Laptops may be used for notetaking and desktop PowerPoint use. Wandering from the

                  appropriate Moodle site or ‘surfing the web’ will adversely affect the policy on use of laptops.
                  Students wandering from appropriate sites will be required to close and not reopen laptops for
                  the remainder of the course.

                  3. Eating is prohibited in the classroom. Beverages are permitted in non-laboratory classrooms.
                  4. Attendance is required by the University. Late arrival and early departures will directly affect

                  both the student’s understanding of the material and therefore potentially the final grade the
                  student earns.

                  5. Students arriving late for class or from breaks may be asked to remain outside the room until
                  the next break.

                  NSG 410 Student Learning Outcomes

                  Upon completion of this course, the student will be able to:

                  1. Identify the critical components of a research report.
                  2. Discuss appropriate use of theory and conceptual frameworks in research.
                  3. Develop a research / evident-based practice question in an area of interest.
                  4. Conduct a literature search on a specific research / practice related topic and write a literature

                  review.
                  5. Analyze methods design, sample and variable measurements, and data collection procedures in

                  research studies and identify the strengths / limitations and appropriateness for practice within
                  each study.

                  6. Utilize national databases to find evidence to support practice as appropriate.

                  Stratford University School of Nursing
                  Syllabus Supplement

                  4

                  COURSE OUTLINE

                  Date Topic/Content Reading Activities

                  Week 1
                  Jan. 3-9, 2022

                  Introduction to Research and
                  Evidence-Based Practice

                  Lobiondo-Wood &
                  Haber,
                  Chapters 1 & 2

                  Introduction Forum
                  Initial Post Due: 1/5

                  Introduce Yourself

                  Practice Quiz with
                  Respondus

                  Week 1 Worksheet

                  Week 2
                  Jan. 10-16, 2022

                  Theory in Research

                  Literature Reviews

                  Lobiondo-Wood &
                  Haber,
                  Chapters 3, 4, & 11

                  Discussion Forum #1
                  Initial Post Due: 1/12
                  Responses Due: 1/14

                  Quiz #1: Jan. 14

                  Work on PICOT
                  Assignment

                  Week 2 Worksheet

                  Week 3
                  Jan. 17-23, 2022

                  Qualitative Research

                  Appraising Qualitative
                  Research

                  Lobiondo-Wood &
                  Haber,
                  Chapters 5,6, & 7

                  Discussion Forum #2
                  Initial Post Due: 1/19
                  Responses Due: 1/21

                  Quiz #2: Jan. 21

                  PICOT Due: 1/22
                  Week 3 Worksheet
                  Work on APA Citations

                  Week 4
                  Jan. 24-30, 2022

                  Quantitative Research
                  • Experimental
                  • Quasi-Experimental
                  • Nonexperimental

                  Appraising Quantitative
                  Research

                  Lobiondo-Wood &
                  Haber,
                  Chapters 8, 9, 10, &
                  18

                  Discussion Forum #3
                  Initial Post Due: 1/26
                  Responses Due: 1/28

                  APA Citations Due: 1/29

                  Week 4 Worksheet

                  Week 5
                  Jan. 31-Feb. 6,
                  2022

                  Sampling

                  Legal and Ethical Issues

                  Lobiondo-Wood &
                  Haber,
                  Chapters 12 & 13

                  Discussion Forum #4
                  Initial Post Due: 2/2
                  Responses Due: 2/4

                  Quiz #3: Feb. 4

                  Work on Literature Table
                  Week 5 Worksheet

                  Stratford University School of Nursing
                  Syllabus Supplement

                  5

                  Week 6
                  Feb. 7-13, 2022

                  Quantitative Research
                  • Data Collection

                  Methods
                  • Reliability and Validity

                  Lobiondo-Wood &
                  Haber,
                  Chapters 14 & 15

                  Discussion Forum #5
                  Initial Post Due: 2/9
                  Responses Due: 2/11

                  Literature Table Due: 2/12

                  Work on Literature Review

                  Week 7
                  Feb. 14-20, 2022

                  Quantitative Research
                  • Data Analysis

                  Lobiondo-Wood &
                  Haber,
                  Chapter 16

                  Discussion Forum #6
                  Initial Post Due: 2/16
                  Responses Due: 2/18

                  Quiz #4: Feb. 18

                  Work on Literature Review

                  Week 7 Worksheet

                  Week 8
                  Feb. 21-27, 2022

                  Understanding Research
                  Findings

                  Lobiondo-Wood &
                  Haber,
                  Chapter 17

                  Literature Review
                  Due: 2/26

                  Week 9
                  Feb. 28-Mar. 6,
                  2022

                  Evidence-Based Nursing
                  Practice

                  Quality Improvement

                  Lobiondo-Wood &
                  Haber,
                  Chapters 20 & 21

                  Discussion Forum #7
                  Initial Post Due: 3/2
                  Responses Due: 3/4

                  Quiz #5: Mar. 4

                  Week 9 Worksheet

                  Week 10
                  Mar. 6-13, 2022

                  Course Wrap-Up Discussion Forum #8
                  Reflection Post

                  Stratford University School of Nursing
                  Syllabus Supplement

                  6

                  Readings

                  Students should expect to spend a minimum of two hours studying or completing assignments outside
                  of class for every credit hour. This course is 4.5 credit hours, so the expectation is that each student
                  will spend at least 9 hours at home studying and completing assignments for this course.

                  It is an expectation that students will read the assigned chapters of the textbook. The lecture will
                  enhance but not substitute for the assigned readings. Videos and interactive learning materials will also
                  be posted on the Moodle page to support learning of concepts. Students are expected to review posted
                  material.

                  This is an online course. It is very important that you communicate effectively with the
                  course instructor in person or via email. Students are expected to use their Stratford email
                  account when communicating with the instructor. It is best practice to read SU Email and
                  Moodle daily for current updates.

                  Assignments

                  Discussion Forums (17.5% of total grade): Students will participate in online forum discussions. See
                  rubric in Syllabus Supplement for grading. Weekly discussion items are to stimulate and engage
                  learning. The student will be asked to critically analyze a topic or concept discussed in class and
                  submit your comments on a threaded discussion board. The student will be responsible for submitting a
                  weekly, two-part assignment:

                  • Part 1: The first part will be a summary of the topic in the student’s own words (minimum of
                  250 words) to demonstrate understanding of the topic. The student is required to cite all sources
                  used in forming the post using proper APA format. Most initial posts will require a “cosmic
                  question” at the end of the summary. The question should be thought-provoking and related
                  to the week’s discussion topic. Part 1 is due on Wednesdays by 2359.
                  **Students will not receive credit for late posts.

                  • Part 2: The second part of the discussion forum aims to keep the student thinking about the big
                  picture. Each student is required to provide a substantive response (minimum of 150 words) to
                  at least two of their classmates’ posts and cosmic questions. Sources used to inform the
                  response should be cited using proper APA format. Part 2 is due on Fridays by 2359.

                  **Students will not receive credit for late posts.

                  Other Assignments (32.5% of total grade)

                  Assignments must be professional in format. All work must be proofread for context, spelling, syntax,
                  and grammatical errors. Formatting must follow accepted academic standards to include proper APA
                  formatting for references and citations. References and citations are expected when material submitted

                  Stratford University School of Nursing
                  Syllabus Supplement

                  7

                  is not the student’s original work (i.e., definitions, evidence-based practices, lists, descriptions, etc.)
                  and to support statements that are not general knowledge. The level of matching on the Turnitin link
                  should be less than 30% and the use of quotations should be kept to a minimum. A maximum of two
                  quotations will be accepted in any assignment.

                  1. PICOT/The Research Question (5%)
                  The student will reflect on clinical nursing practice and write a research question. The question
                  will be developed by using the PICOT framework (Population, Intervention, Comparison,
                  Outcome, Time). The student will identify a nursing clinical question as follows:

                  • What individual or group am I curious about? (population)
                  • What key intervention am I curious about? (intervention)
                  • What intervention will I be comparing? (comparison)
                  • What do I hope to accomplish, or What would happen if I did this? (outcome)
                  • How much time will the intervention take to achieve the desired effects? (time)

                  The aim of the PICOT is to discover current research and promote best practices. The PICOT
                  will guide the Literature Review. The PICOT must have a nursing clinical focus. A rationale
                  for each element of the PICOT question must be provided and supported by a credible source.

                  Students will be able to resubmit the PICOT assignment one time.

                  2. APA Citations Assignment (5%)

                  Select 5 primary research articles published in peer reviewed journals. Write a simple
                  sentence for each article to demonstrate your knowledge of formatting in-text citations using
                  current APA guidelines. Then provide an APA-formatted reference list for the 5 articles.

                  3. Literature Review Table (7.5%)
                  A Literature Review Table provides a succinct overview of each article. The table is especially
                  useful when synthesizing the information from articles, as the main elements are clearly
                  identified. Complete the Literature Review Table using the articles identified from your
                  literature search that will be used in your Literature Review.

                  Students will be able to resubmit the Literature Review Table assignment one time.

                  4. Literature Review (15%)
                  Each student must prepare a literature review in relation to the PICOT. This is an opportunity
                  to read as a scholar and develop competence in analyzing the key elements of a research article.
                  The student should select five primary research studies from the literature search that was
                  conducted – each study must have been published in a peer-reviewed journal within the last 5-8
                  years with at least one study published in a nursing journal. Next, analyze and appraise the
                  merits of each manuscript. Then, synthesize the findings to compare the studies and determine
                  the strength of the evidence to answer your PICOT question. Last, write a paper (6-9 pages).
                  See rubric to guide development of the assignment.

                  **No review articles of any kind are appropriate for this assignment – select only primary
                  research articles.**

                  Stratford University School of Nursing
                  Syllabus Supplement

                  8

                  Quizzes (50%)

                  1. Quizzes (10% each): Students will complete five quizzes. Each quiz must be completed with
                  Respondus LockDown Browser on the assigned date. The student’s entire face must be
                  visible in the camera during the entire quiz. No hats, sunglasses, headphones/earbuds may be
                  worn during the quizzes – these are grounds for suspicious student activity. Following the
                  quiz, the instructor will review all Respondus LockDown Browser reports and footage. Any
                  abnormal or suspicious activity detected by Respondus LockDown Browser could result in
                  the student’s grade being changed to a “0.”

                  The quizzes are challenging, and lack of preparation puts the student at risk for failing the quiz and
                  possibly the course. Avoid procrastination and use resources posted on Moodle to prepare.

                  Exam items are selected based on course content and the level of the course in the program progression
                  schema. Exam questions are selected to primarily evaluate Bloom’s cognitive levels of analysis,
                  synthesis, and evaluation. Exam questions may be multiple choice, multiple select, or other alternate
                  item formats.

                  Students who begin the quiz late will have the option of taking the test but within a shortened period.
                  Students who do not score a minimum of 80% on an exam are required to meet with faculty.

                  Exam Make-up

                  In the event a student is cognizant of a situation that will prohibit them from taking an exam
                  (i.e., hospitalization, emergency, etc.), the student is responsible to and must contact the
                  instructor by email/ office phone prior to the exam to schedule a time to take the exam.

                  Students who miss the exam due to an approved absence or documented emergency may be
                  required to submit evidence supporting these claims. If the claims are verified, the student will
                  be allowed to make up the exam without a point penalty. Students are allowed one make-up
                  exam per term. The make-up must be completed within 5 workdays from the absence including
                  the day of absence.

                  Students who miss an exam due to an unexcused absence, undocumented emergency or tardiness will
                  receive a zero without an opportunity to the make-up exam.

                  Exam Item Analysis

                  Following each exam, and before grades are posted, each exam question is analyzed. The exam
                  item analysis is used to evaluate student performance as well as the validity of exam items.
                  Should an exam question fail analysis, the question(s) will be eliminated and only the total
                  number of questions answered correctly out of the total number of remaining questions will be
                  scored for all students. Under no circumstances can a student receive a grade more than 100%.

                  Late Work

                  Discussions/assignments must be submitted on or before the scheduled date and time. All assignments
                  have a due date and time posted, and it is the student’s responsibility to know when the assignment is
                  due. Assignments will close at the designated time.

                  Stratford University School of Nursing
                  Syllabus Supplement

                  9

                  No work will be accepted beyond this time, and a grade of zero will be posted. Emailed
                  assignments will not be accepted.

                  Moodle provides students a 30-minute window only to make edits before discussion/assignment is
                  “final.” The time posted on the assignment is used to determine the submission time. Be sure to post at
                  least 30 minutes earlier than the discussion/assignment is due to avoid late submissions. Forums for
                  Moodle assignments open and close automatically based upon due times. If the student has a problem
                  with the Moodle page, then the student must take a screen print of the error message and include it in
                  an email to the helpdesk and instructor at the time it occurs. Late assignments will not be accepted,
                  and a grade of zero will be entered into the discussion/forum/assignment.

                  Grade Item Unit Percentage Percentage of Total Grade

                  Quizzes and Examinations 50%

                  Quiz 1 10

                  Quiz 2 10

                  Quiz 3 10

                  Quiz 4 10

                  Quiz 5 10

                  Written Assignments 32.5%

                  PICOT 5

                  APA Assignment 5

                  Literature Table 7.5

                  Literature Review 15

                  Discussions 17.5%

                  Discussion 1 2.5

                  Discussion 2 2.5

                  Discussion 3 2.5

                  Discussion 4 2.5

                  Discussion 5 2.5

                  Discussion 6 2.5

                  Discussion 7 2.5

                  Discussion 8 0 – attendance

                  Total 100%

                  Stratford University School of Nursing
                  Syllabus Supplement

                  10

                  Office Hours

                  Office hours for this class are available by appointment. Please email to arrange an appointment.

                  Students may wish to purchase the study guide that accompanies the textbook, as it has many exercises
                  that will assist them to practice the main concepts of research.

                  Learning Resource Center (LRC)

                  Each Stratford University campus has a LRC with a dedicated staff. The LRC offers computer
                  terminals, a physical collection developed specifically for Stratford’s programs, and access to multiple
                  research databases and eBooks. Students are encouraged to use the LRC resources throughout their
                  program to supplement classroom instruction and assigned textbooks. Please visit your campus LRC
                  for information about policies and procedures. The electronic resources, along with information about
                  LRC holdings, can be accessed through the Stratford University website.

                  Students are expected to use the 7th Edition of the APA Publication Manual:

                  American Psychological Association. (2020). Publication manual of the American Psychological
                  Association (7th ed.). Washington, DC: American Psychological Association. (ISBN-13: 978-
                  1433832161 or ISBN-10: 143383216X )

                  Stratford University School of Nursing
                  Syllabus Supplement

                  11

                  Grading Rubrics:

                  Discussion Forums

                  Discussion
                  Forums

                  Item Expectation % Points Total Item
                  percentage

                  Total
                  percentage

                  Timing Initial post

                  Posted by the due date. 10% 15% 25%
                  At least 250 words.

                  5%

                  Response
                  post

                  Posted by the due date. 5% 10%
                  At least 150 words.

                  5%

                  Content Initial post Answer must address and be relevant
                  to all questions

                  35% 40% 65%

                  Readability

                  5%

                  Cosmic
                  Question

                  Must be related to the chapter under
                  discussion.

                  10% 10%

                  Response Must respond to two peers’ cosmic
                  question.

                  15% 15%

                  Citation Referencing
                  in in APA
                  7th edition
                  style

                  Must have both intext citation and a
                  reference list.

                  10% 10% 10%

                  Total 100%

                  Stratford University School of Nursing
                  Syllabus Supplement

                  12

                  PICOT Rubric

                  PICOT Weight Present Absent

                  Patient/Population (add rationale with reference) Required
                  Intervention (add rationale with reference) Required
                  Comparison (add rationale with reference) Required
                  Outcome (add rationale with reference) Required
                  Timing (add rationale with reference) Optional

                  Total:

                  (100% possible)

                  PICOT demonstrates applicability to nursing
                  profession

                  PICOT will be returned if
                  not nursing-related

                  Submitted by deadline
                  No late assignments
                  accepted

                  APA Assignment grading Rubric

                  APA Assignment grading Rubric % Total
                  5 in-text citations formatted using current
                  APA guidelines

                  10% for each correctly cited in-text citation 50%

                  Reference list of 5 articles formatted
                  using current APA guidelines

                  10% for each correctly cited reference list 50%

                  Grand total
                  100%

                  Stratford University School of Nursing
                  Syllabus Supplement

                  13

                  Literature Review Table Rubric

                  Literature Review Table Rubric
                  Unsatisfactory

                  0
                  Partially Proficient

                  15
                  Proficient

                  20
                  Exemplary

                  25
                  Score

                  Articles 0-1 primary research
                  articles are identified

                  2-3 primary research
                  articles are identified.

                  4 primary
                  research articles
                  are identified.

                  5 primary research
                  articles are identified.

                  Articles
                  appropriate
                  to PICOT

                  0-1 primary research
                  articles appropriate to
                  PICOT

                  2-3 primary research
                  articles appropriate to
                  PICOT

                  4 primary research
                  articles appropriate to
                  PICOT

                  5 primary research
                  articles appropriate to
                  PICOT

                  Articles
                  uploaded to
                  Moodle

                  0-1 primary research
                  articles are included
                  with table

                  2-3 primary research
                  articles are included
                  with table

                  4 primary research
                  articles are included
                  with table

                  5 primary research
                  articles are included with
                  table

                  Table There are major
                  errors in the table

                  There are several
                  errors and/or
                  incomplete data

                  There are some
                  missing data and/or
                  errors

                  The table is completed
                  appropriately

                  Total /100

                  Stratford University School of Nursing
                  Syllabus Supplement

                  14

                  Literature Review Rubric

                  Introduction:
                  • Provides rationale for

                  student selection of
                  literature

                  • Discussed search terms
                  and techniques.

                  • Demonstrates the need for
                  this research question

                  Clinical Question (PICOT)

                  • Includes the clinical
                  question

                  Appraisal of Articles:
                  Uses established critical appraisal
                  criteria to evaluate essential
                  components of each reviewed
                  study, including but not limited
                  to:

                  • Type and size of sample
                  • Reliability and validity of

                  instruments
                  • Methodology
                  • Consistency of data

                  collection and procedures
                  • Appropriate data analysis
                  • Results
                  • Identification of

                  limitations

                  Synthesis/Conclusion:
                  • Reflection on the analysis

                  and synthesis of material
                  • Identifies gaps and

                  inconsistencies
                  • Summarizes overall

                  strengths and weaknesses of
                  the studies reviewed

                  • Discuss similarities and
                  differences of articles

                  Grammar

                  15-10 10-5 5-0

                  Meets all outlined criteria
                  and is succinct and
                  sufficient. Logically
                  demonstrates the need for
                  this research question

                  Does not meet one of
                  the criteria but is well
                  organized, and
                  sufficient. Logically
                  demonstrates the need
                  for this research
                  question.

                  Does not meet two or
                  more of the criteria and/
                  or is not organized, and
                  sufficient. The reader
                  cannot conclude the “so
                  what”.

                  5 3 0

                  Clinical question is clearly
                  stated

                  Clinical question can
                  be implied but was not
                  clearly stated.

                  Clinical question was
                  not stated and/or were
                  not apparent from the
                  literature review.

                  35-25 25-15 15-0
                  The appraisal reflects
                  accurate analysis of the
                  essential components for
                  all studies
                  Five appropriate articles
                  are reviewed.

                  The appraisal reflects
                  most (lacking 2 or
                  more elements) of the
                  essential components
                  for one or all the
                  studies
                  Four appropriate
                  articles are reviewed.

                  The appraisal reflects
                  some (lacking 4 or
                  more elements) of the
                  essential components
                  for either study
                  Three or fewer
                  appropriate articles
                  are reviewed.

                  25-15 15-10 10-5
                  Meets criteria. Well
                  organized, follows a
                  logical sequence that
                  allows the reader to arrive
                  at a logical conclusion.
                  PICOT conclusion is
                  clear and well-supported
                  by the literature.

                  Does not meet 1-2 of
                  the criteria but is
                  organized, and/or
                  demonstrates illogical
                  sequencing or structure.
                  Conclusions relating to
                  PICOT are vague
                  and/or unsupported by
                  the literature.

                  Does not meet >2
                  criteria and/or is
                  weakly organized with
                  no logical sequencing
                  or structure.
                  Conclusions relating
                  to PICOT cannot be
                  made.

                  10-7 6-4 3-0
                  There are no major
                  grammatical errors.

                  There are a few
                  grammatical errors.

                  There are major
                  grammatical errors.

                  Stratford University School of Nursing
                  Syllabus Supplement

                  15

                  Support and Referencing:

                  • See Turn-It-In
                  • SEE SON

                  INTEGRITY
                  STATEMENT

                  10-8 7-5 4-0
                  Incorporates the text,
                  course materials, and
                  selected readings; does not
                  use Wikipedia or other
                  non-academic resources.
                  There are minimal to no
                  errors in formatting,
                  referencing and style.

                  There are moderate
                  errors in APA
                  formatting, style, and
                  referencing.

                  Severe errors in APA
                  style, formatting, or
                  referencing. Violates
                  the School of Nursing
                  Student’s Personal
                  Integrity Statement
                  more than 2 times.

                  Stratford University School of Nursing
                  Syllabus Supplement

                  16

                  Student Personal Integrity Statement

                  I, (print your name here), am provided a hard copy (or e-copy for
                  online courses) of the Syllabus and Syllabus Supplement in NSG 410. I am aware of:

                  • All due dates, including exams, assignments, and …

                  RESEARCH

                   Respond to the questions below by reviewing the article and identifying those elements (state the page number you found the element). As you discuss the researcher’s use of the element, make sure your discussion is properly supported by  your textbook. 

                   

                  Your critique responses should reflect upon the following:
                  1. What type of qualitative approach did the researcher use? Provide a definition of the type of approach. 
                  2. What type of sampling method did the researcher use? Is it appropriate for the study? Why or why not?
                  3. Discuss whether the data collection focused on human experiences.
                  4. How did the author address the protection of human subjects?
                  5. How did the researcher describe data saturation?
                  6. What procedure for collecting data did the researcher use?
                  7. Describe the strategies the researcher used to analyze the data.
                  8. How did the researcher address the following:

                  • Credibility 
                  • Auditability 
                  • Fittingness 

                  9. What is your cosmic question?

                  • 10

                  RESEARCH

                       

                       

                   1. Minimizing bias and decreasing threats to internal validity is important to experimental designs. Explain how a researcher uses manipulation, randomization, and control to minimize bias and decrease threats to internal validity.

                  2. Many times, researchers state that randomized control trials (RCT) provide the strongest level of evidence for an individual study. As a consumer of research, do you think this statement is true? Why or why not?

                  3. When conducting an experimental study, discuss how the researcher will use intervention fidelity to increase the strength and quality of the evidence provided by the findings of the study.

                  4. What is your Cosmic Question? (This is a question you will ask your peers to respond to based on the this week’s topic of Quantitative Research.)

                    • 15

                    RESEARCH

                     

                    1. Minimizing bias and decreasing threats to internal validity is  important to experimental designs. Explain how a researcher uses  manipulation, randomization, and control to minimize bias and decrease  threats to internal validity.

                    2. Many times, researchers state  that randomized control trials (RCT) provide the strongest level of  evidence for an individual study. As a consumer of research, do you think this statement is true? Why or why not?

                    3.  When conducting an experimental study, discuss how the researcher will  use intervention fidelity to increase the strength and quality of the  evidence provided by the findings of the study.

                    4. What is your Cosmic Question? (This is a question you will ask your peers to respond to based on the this week’s topic of Quantitative Research.)

                     LoBiondo-Wood, G., & Haber, J. (2022). Nursing research: Methods and critical appraisal for evidence-based practice. Elsevier.  

                      • 8

                      Research

                      see attachment

                      • 20

                      RESEARCH

                      MH Nurses_FW.pdf

                      Mental Health Nurses’ Attitudes and Perceived Self-Efficacy Toward Inpatient Aggression

                      12 Perspectives in Psychiatric Care 52 (2016) 12–24
                      © 2014 Wiley Periodicals, Inc.

                      Mental Health Nurses’ Attitudes and Perceived Self-Efficacy
                      Toward Inpatient Aggression: A Cross-Sectional Study of
                      Associations With Nurse-Related Characteristics
                      Sofie Verhaeghe, PhD, RN,* Veerle Duprez, MSc, RN,* Dimitri Beeckman, PhD, RN, Joris Leys, MSc, RN,
                      Berno Van Meijel, PhD, RN, and Ann Van Hecke, PhD, RN

                      SofieVerhaeghe, PhD,RN, is Professor,UniversityCentre forNursingandMidwifery,Departmentof PublicHealth, FacultyofMedicineandHealth
                      Sciences,GhentUniversity,Ghent, BelgiumandResearcher,DepartmentofNursing,VivesUniversityCollege Leuven,Roeselare, Belgium;Veerle
                      Duprez,MSc,RN, is PhDstudent,UniversityCentre forNursingandMidwifery,Departmentof PublicHealth, FacultyofMedicineandHealthSciences,
                      GhentUniversity,Ghent, BelgiumandLecturer&Researcher,DepartmentofBachelor inNursing,ArteveldeUniversityCollegeGhent,Ghent, Belgium;
                      Dimitri Beeckman, PhD,RN, is Professor,UniversityCentre forNursingandMidwifery,Departmentof PublicHealth, FacultyofMedicineandHealth
                      Sciences,GhentUniversity,Ghent, BelgiumandResearcher,DepartmentofBachelor inNursing,ArteveldeUniversityCollegeGhent,Ghent, Belgium;
                      Joris Leys,MSc,RN, is Lecturer&Researcher,DepartmentofBachelor inNursing,ArteveldeUniversityCollegeGhent,Ghent, Belgium;BernoVan
                      Meijel, PhD,RN, is ProfessorofMentalHealthNursing, ResearchGroupMentalHealthNursing, InhollandUniversity ofAppliedSciences,Amsterdam,
                      Departmentof Psychiatry,VUUniversityMedicalCenter,AmsterdamandParnassia Psychiatric Institute, TheHague, TheNetherlands; andAnnVan
                      Hecke, PhD,RN, is Professor,UniversityCentre forNursingandMidwifery,Departmentof PublicHealth, FacultyofMedicineandHealthSciences,
                      GhentUniversity,Ghent, BelgiumandScientific Staff,NursingScience,UniversityHospitalGhent,Ghent, Belgium.

                      Search terms:
                      Attitude,patient aggression, predictor,
                      psychiatric nursing, self-efficacy

                      Author contact:
                      veerle.duprez@ugent.be,witha copy to the
                      Editor: gpearson@uchc.edu

                      Conflict of Interest Statement
                      Theauthorsdeclare that theyhaveno
                      competing interests.

                      Author Contributions
                      SV,VD, andAVHconceivedanddeveloped the
                      designof the study. SVand JL carriedout the
                      data collection.VD,DB, andAVHcarriedout
                      thedataanalyses. SV,VD, JL, andBVM
                      contributed to the interpretationof thedata.
                      All authors contributed indrafting the
                      manuscript, and readandapproved thefinal
                      version.

                      *Bothauthors contributedequally to thiswork

                      First Received June6,2014; Final Revision
                      receivedOctober25,2014;Accepted for
                      publicationNovember13,2014.

                      doi: 10.1111/ppc.12097

                      PURPOSE: To explore mental health nurses’ attitude and self-efficacy to adult inpa-
                      tient aggression, and to explore the association with nurse-related characteristics.
                      DESIGN AND METHOD: Cross-sectional study in a sample of 219 mental health
                      nurses in nine psychiatric hospitals, with stepwise linear regression analysis to detect
                      predictive models.
                      FINDINGS: Female and less experienced nurses were less likely to blame patients
                      for their behavior. Gender, burnout, secondary traumatic stress, and compassion
                      satisfaction accounted for 26.2% of the variability in mental health nurses’ self-
                      efficacy toward aggression.
                      PRACTICE IMPLICATIONS: There needs to be attention to professional quality of
                      life for mental health nurses, to provide them with of self-efficacy and a positive atti-
                      tude toward coping with aggression.

                      Healthcare professionals, and in particular mental health
                      nurses, are regularly confronted with aggression (Foster,
                      Bowers, & Nijman, 2007; Jansen, Dassen, Burgerhof, &
                      Middel, 2006; Nijman et al., 1999; Rippon, 2000). For this
                      study, aggression was broadly defined as “any verbal, nonver-
                      bal or physical behaviour that was threatening (to self, others
                      or property), or physical behaviour that actually did harm (to
                      self, others or property)” (Morrison, 1990, p. 67). The preva-

                      lence of aggressive incidents in psychiatric hospitals varies
                      considerably across countries (Bowers et al., 2011). A review
                      by Nijman, Palmstierna, Almvik, and Stolker (2005) revealed
                      a mean of 9.3 incidents per patient per year for adults with
                      mental illness, with a range of 0.4–33.2 incidents per patient
                      per year. Severity ranged from 9.2 to 11.0 points on a scale of
                      0–22 points, with higher scores indicating more severe
                      aggression (Nijman et al., 2005). This variation in incidence

                      Perspectives in Psychiatric Care ISSN 0031-5990

                      Mental Health Nurses’ Attitudes and Perceived Self-Efficacy Toward Inpatient Aggression

                      can partly be explained by differences in defining aggression
                      and in registration methods, different care settings, and a
                      decreased tendency to less threatening incidents
                      (Bowers et al., 2011; Nijman et al., 2005). An aggression reg-
                      istration study (n = 437) in psychiatric hospitals for adults in
                      Belgium using the Staff Observation Aggression Scale-
                      Revised (SOAS-R) (Nijman et al., 1999) revealed a mean of
                      1.71 incidents per patient per year, with an average severity
                      score of 9.69 (SD 5.04). A small group of patients (2%)
                      appeared to be responsible for 50% of the incidents
                      (Verhaeghe et al., 2011).

                      Aggressive inpatient incidents have a multifactorial and
                      complex nature (Abderhalden, Needham, & Dassen, 2008;
                      Nijman et al., 1999). Occurrence of incidents, as well as their
                      management, all reflects patient, ward, and staff variables in
                      interaction (Abderhalden et al., 2008; Fluttert et al., 2008;
                      Nijman et al., 1999; Nijman, de Kruyk, & Van
                      Nieuwenhuizen, 2004).

                      Conceptual Framework

                      To gain insight into mental health nurses’ behavior toward
                      aggressive patients, it is useful to understand the predictors of
                      this behavior. The theory of planned behavior (TPB) provides
                      a useful conceptual framework to accomplish this. According
                      to the TPB, a person’s behavior is guided by his intentions,
                      which refers to a person’s readiness to perform a given behav-
                      ior (Fishbein & Ajzen, 2010). These intentions derive from
                      attitudes, subjective norms, and self- efficacy (Azjen, 1988; De
                      Vries, 1988) of the person (see Figure 1). Attitudes refer to a
                      person’s evaluation of the behavior as more positive or nega-
                      tive (Fishbein & Ajzen, 2010). Subjective norms encompass
                      the influence of the judgments of others who are deemed
                      important and the tendency to conform to that judgment
                      (Fishbein & Ajzen, 2010). Self-efficacy or perceived behav-
                      ioral control is the belief one has in his or her own ability to
                      succeed in specific situations (Bandura, 1991; Fishbein &

                      Ajzen, 2010). Two factors of the TPB—attitudes and self-
                      efficacy—are included in this study because they fall within
                      the control of the individual nurse to achieve a more positive
                      attitude toward aggressive patients or a higher level of self-
                      efficacy, thus likely contributing to a better working alliance
                      with improved treatment outcomes (de Leeuw, Van Meijel,
                      Grypdonck, & Kroon, 2012).

                      Attitudes Toward Inpatient Aggression

                      Attitudes toward aggression are comprised of three perspec-
                      tives (Abderhalden, Needham, Friedli, Poelmans, & Dassen,
                      2002; Bowers et al., 2011; Jansen, Middel, & Dassen, 2005;
                      Jansen, Dassen, et al., 2006). First, aggression is perceived as a
                      dysfunctional phenomenon that is violent, offensive, destruc-
                      tive, intrusive, or harmful; second, aggression can also be per-
                      ceived as a functional, instrumental, or communicative
                      phenomenon, a feeling expressed to meet a particular need;
                      and third, aggressive behavior can be interpreted as a normal
                      or protective phenomenon, where aggression is an acceptable
                      reaction to feelings of anger. The last two perspectives are
                      highly interlinked and related to a more tolerant, permissive
                      attitude toward aggression (Jansen, Middel, & Dassen, 2005).
                      Research reveals that most often, mental health nurses view
                      aggression as a harmful, offensive, and destructive behavior
                      on the part of the patient (Finnema, Dassen, & Halfens, 2004;
                      Jansen, Middel, Dassen, & Reijneveld, 2006; Jonker,
                      Goossens, Steenhuis, & Oud, 2008). Few of them emphasize
                      the positive, protective nature of aggression (Jansen, Middel,
                      et al., 2006; Jonker et al., 2008). It is assumed that mental
                      health nurses with more tolerant, permissive, and positive
                      attitudes may have better clinical skills to respond to incidents
                      of aggression. This statement is supported in different health-
                      care domains, demonstrating the impact of positive attitudes
                      on the quality of nursing practice, for instance, in the applica-
                      tion of adequate pressure ulcer prevention (Beeckman,
                      Defloor, Schoonhoven, & Vanderwee, 2011). The capacity to

                      Figure 1. ConceptualModel of theStudyBasedon theTheoryof PlannedBehavior

                      13Perspectives in Psychiatric Care 52 (2016) 12–24
                      © 2014 Wiley Periodicals, Inc.

                      Mental Health Nurses’ Attitudes and Perceived Self-Efficacy Toward Inpatient Aggression

                      see aggression in a more positive perspective is reflected in the
                      use of fewer coercive measures (Jonker et al., 2008) and con-
                      tributes to a better working alliance with improved treatment
                      outcomes (de Leeuw et al., 2012).

                      Perceived Self-Efficacy

                      Based on Bandura’s (1991) theory of self-efficacy, it is
                      assumed that the perceived level of self-efficacy toward
                      aggression will influence nurses’ actual reaction to and behav-
                      ior toward aggressive incidents. This assumption is exten-
                      sively supported in research on the self-management
                      behavior of persons with chronic illness (Bonsaksen, Lerdal,
                      & Fagermoen, 2012; Marks, Allegrante, & Lorig, 2005) and in
                      research on nursing competencies and perceived skills
                      (Nørgaard, Ammentorp, Ohm Kyvik, & Kofoed, 2012; Van
                      Hecke, Grypdonck, Beele, De Bacquer, & Defloor, 2009). A
                      mental health nurse who perceives that he/she has a low self-
                      efficacy is more likely to see a potential violent situation as
                      dangerous and threatening, and thus may react in a
                      nontherapeutic way. Alternatively, perceived high self-
                      efficacy in dealing with aggression, with the corresponding
                      feelings of security and self-confidence, is an important con-
                      dition for therapeutic interactions between patients and
                      mental health nurses (Dunn, Elsom, & Cross, 2007; Lowe,
                      Wellman, & Taylor, 2003; Martin & Daffern, 2006; Totman,
                      Hundt, Wearn, Paul, & Johnson, 2011).

                      Considered within the context of the conceptual frame-
                      work, attitudes and self-efficacy of mental health nurses
                      toward aggressive behavior are in turn influenced by nurse-
                      related characteristics (Azjen, 1988) (see Figure 1). Studies
                      have provided contradictory findings about the influence of
                      nurse-related characteristics on attitudes toward aggression.
                      Some studies that nurses who have had less contact
                      with aggressive patients because of part-time schedules or
                      fewer years of work experience, tend to have a more positive
                      attitude toward aggressive incidents (Jansen, Dassen, et al.,
                      2006; Jansen, Middel, et al., 2006; Palmstierna & Barredal,
                      2006). This is in contrast with the study by Whittington
                      (2002), which demonstrated that tolerance for aggression is
                      higher among more experienced nurses (more than 15 years).
                      Furthermore, the study of Jansen, Middel, et al. (2006)
                      revealed that female nurses agreed more than their male col-
                      leagues that aggression is a destructive phenomenon, in con-
                      trast to the opposite results of Palmstierna and Barredal
                      (2006). The study by Abderhalden et al. (2002) found no rela-
                      tionship between the perception of aggression and staff char-
                      acteristics. These previous studies focused on identification of
                      the appraisal and tolerance toward aggressive incidents. They
                      did not provide information on other interesting aspects of
                      attitudes toward aggressive incidents, such as the belief in pre-
                      dictability of incidents, feelings of security or anxiety, feelings
                      of competence in managing violent behavior, confidence in

                      dealing with aggressive incidents, and possible association
                      with nurse-related characteristics. These aspects of attitudes
                      can provide useful information for hospital managers and
                      staff in evaluating and improving aggression management
                      programs and policies.

                      Research on the association between mental health nurses’
                      perceived level of self-efficacy in managing inpatient aggres-
                      sion and nurse-related characteristics is limited, and was
                      conducted within a mixed population of mental health pro-
                      fessionals, including just a small sample of mental health
                      nurses (Lowe et al., 2003; Martin & Daffern, 2006; Totman
                      et al., 2011).

                      Since aggressive incidents and verbal threats are linked with
                      anxiety, symptoms of post-traumatic stress disorder, and
                      symptoms of burnout (Gascon et al., 2013; Whittington,
                      2002), they can cause an internal value conflict (Winstanley &
                      Whittington, 2004). This might affect nurses’ attitudes and
                      self-efficacy toward aggressive patients and incidents. To date,
                      it is not clear if an association exists between mental health
                      nurses’ perceived professional quality of life and attitude or
                      self-efficacy toward inpatient aggression. This study included
                      perceived professional quality of life as a nurse-related
                      characteristic.

                      We may conclude that studies have provided contradictory
                      or limited findings about the influence of nurse-related char-
                      acteristics on attitude and self-efficacy toward aggression. To
                      eliminate this gap, this study aimed to explore mental health
                      nurses’ attitudes and perceived self-efficacy toward inpatient
                      aggression in adult psychiatric hospitals. The second aim was
                      to explore the associations between attitudes and perceived
                      self-efficacy toward aggression and nurse-related characteris-
                      tics. The nurse-related characteristics under study are per-
                      ceived professional quality of life, age, gender, educational
                      degree, degree in psychiatric nursing, and length of work
                      experience. A comprehensive exploration of mental health
                      nurses’ attitudes and perceived self-efficacy, and their associa-
                      tion with nurse-related characteristics, including the per-
                      ceived professional quality of life, is important to develop
                      tailored interventions to support mental health nurses in
                      managing aggression.

                      Methods

                      Setting and Sample

                      This study focused on mental health nurses working in psy-
                      chiatric hospitals. The selection of participants was per-
                      formed in two phases. In phase 1, the Belgian Federal Public
                      Service of Health Care emailed all psychiatric hospitals for
                      adults (N = 63) in Belgium to invite them to participate in an
                      implementation study on aggression management. Nine psy-
                      chiatric hospitals agreed to participate. In phase 2, a purpo-
                      sive sample of wards from the nine participating hospitals was

                      14 Perspectives in Psychiatric Care 52 (2016) 12–24
                      © 2014 Wiley Periodicals, Inc.

                      Mental Health Nurses’ Attitudes and Perceived Self-Efficacy Toward Inpatient Aggression

                      drawn. A minimum of one and maximum of three wards,
                      where frequent incidents of aggression were reported by
                      nursing directors, were selected from each hospital. To maxi-
                      mize the representativeness of the sample, wards were
                      selected for differentiation, such as type of wards (acute
                      admission vs. chronic care wards), psychopathology (depres-
                      sion, psychosis, or addiction care), and number of beds
                      (ranging from small residential groups to wards with 50
                      beds). Psychiatric wards for forensic care were excluded. The
                      final selection of wards was made in consultation with the
                      nursing directors of the participating hospitals, taking into
                      account organizational elements, such as prolonged absences
                      of staff members, or other implementation processes that
                      were occurring on the ward. A total of 17 wards participated.
                      All nurses (N = 219) working on the included wards were
                      invited to participate in the study.

                      Data Collection

                      Data were collected through self-administered question-
                      naires completed by the nursing staff on the participating
                      wards between November and December 2011. The question-
                      naires consisted of the Attitude Toward Aggressive Behavior
                      Questionnaire (ATABQ) (Collins, 1994) for measuring atti-
                      tude, the Confidence in Coping With Patient Aggression
                      Instrument (CCPAI) (Thackrey, 1987) for self-efficacy, the
                      Professional Quality of Life Questionnaire (ProQoL)
                      (Stamm, 2010) for professional quality of life, and a record of
                      demographic data including age, gender, educational degree,
                      education in psychiatric nursing, years of work experience in
                      psychiatric care, and years of work experience on the ward.
                      During a staff meeting, the research team informed the nurses
                      of the participating wards about the purpose and procedures
                      of the study. The nurses were asked to complete the question-
                      naires individually during this staff meeting. Two occasions
                      were selected to provide all nurses the opportunity to partici-
                      pate in the study. All eligible nurses from the selected wards
                      participated in the study.

                      Instruments

                      Attitude. Most instruments to measure attitudes toward
                      aggression focus on the identification of the appraisal and
                      tolerance toward aggressive incidents (Duxbury, Hahn,
                      Needham, & Pulsford, 2008; Jansen, Dassen, et al., 2006;
                      Whittington, 2002). This study was designed to investigate the
                      broad range of aspects related to nurses’ attitudes toward
                      aggression, broader than the appraisal of aggressive incidents.
                      The ATABQ developed by Collins (1994) provided such a
                      broad range of aspects, which are reflected in its subscales. The
                      12 statements on aggressive behavior of patients are divided
                      into five subscales: patient responsibility for aggression, staff
                      safety, predictability of incidents, competence in managing

                      violent behavior, and confidence of staff in dealing with
                      aggressive incidents. Items are scored on a 5-point Likert scale
                      from 1 (strongly disagree) to 5 (strongly agree). Scores ranged
                      from 1 to 5 at subscale level and from 12 to 60 at scale level, with
                      a higher score indicating a more positive attitude. The lack of
                      reference scores and cutoff points allowed only the interpreta-
                      tion of a mean score in relation to the mean score of another
                      group. The ATABQ test–retest reliability is 0.97 (Collins,
                      1994).

                      Self-Efficacy. The CCPAI developed by Thackrey (1987) has
                      the capacity to monitor perceived self-efficacy toward aggres-
                      sion in a comprehensive and one-dimensional way. It was
                      developed for use in mental healthcare settings (Thackrey,
                      1987). The instrument includes 10 statements, scored on an
                      11-point Likert scale, ranging from 1 (very uncomfortable) to
                      11 (very comfortable). Scores ranged from 10 to 110, with a
                      higher score indicating a higher level of self-efficacy toward
                      inpatient aggression. The CCPAI lacks cutoff scores, so a
                      mean score can only be interpreted in relation to the mean
                      score of another group. Previous studies with the CCPAI
                      showed an internal consistency of α = .88 (Thackrey, 1987)
                      and α = .92 (Allen & Tynan, 2000).

                      Professional Quality of Life. The ProQoL was used to measure
                      the professional quality of life. The ProQoL assesses general
                      job satisfaction (Stamm, 2010). It can be adapted to any pro-
                      fession that chooses to help others (Stamm, 2010). The
                      instrument includes 30 statements divided into three
                      subscales: compassion satisfaction, burnout, and secondary
                      traumatic stress (Stamm, 2010). Compassion satisfaction is
                      referring to the pleasure one derives from being able to do his
                      work. Burnout is referring to feelings of hopelessness and dif-
                      ficulties in dealing with work or doing the job effectively. Sec-
                      ondary traumatic stress is a negative feeling driven by fear and
                      work-related trauma. The statements are scored on a 5-point
                      Likert scale. The ProQoL has good internal consistency for its
                      subscales: compassion satisfaction (α = .88), burnout
                      (α = .75), and secondary traumatic stress (α = .81) (Stamm,
                      2010). The ProQoL was already used in research on the job
                      satisfaction of mental health nurses (Lauvrud, Nonstad, &
                      Palmstierna, 2009; Newell & MacNeil, 2011).

                      The set of instruments was translated into Dutch and
                      French by a back-forward translation procedure with mono-
                      lingual testing. A two-round Delphi procedure with profes-
                      sional translators and healthcare professionals was used for
                      the forward translation. In order to assess comprehensive-
                      ness, the translated instruments were presented to a group of
                      seven mental healthcare nurses and seven researchers during
                      individual interviews. These interviews resulted in only
                      minor changes to optimize the comprehensibility of the
                      translated questionnaires. The professional translators con-
                      ducted a backward translation for verification. No further

                      15Perspectives in Psychiatric Care 52 (2016) 12–24
                      © 2014 Wiley Periodicals, Inc.

                      Mental Health Nurses’ Attitudes and Perceived Self-Efficacy Toward Inpatient Aggression

                      comments were provided. The internal consistency reliability
                      of the translated instruments was assessed and is presented in
                      Table 1.

                      Ethical Considerations

                      This study was approved by the Ethical Review Committee of
                      Ghent University Hospital and by the local committees of the
                      participating hospitals (No. B67020109275). All participants
                      were given detailed information (written and verbal) about
                      the study and signed an informed consent.

                      Data Analysis

                      SPSS v21 (SPSS Inc., Chicago, IL, USA) was used for all statisti-
                      cal analyses. A significance level of .05 was used. Descriptive
                      statistics (counts, percentages, means, and standard deviation)
                      were calculated. The data were verified for normality of distri-
                      bution and equality of variances. With respect to group com-
                      parisons, independent Student’s t tests or one-way analysis of
                      variance (ANOVA) was used. To avoid type I errors, compari-
                      son of four groups was conducted using an adjusted alpha level
                      of .0125. Pearson’s correlation coefficients were calculated to
                      measure the strength of associations between the outcomes
                      under measure (attitude and self-efficacy) and the nurse-
                      related characteristics at scale level (age, work experience, and
                      professional quality of life). To explore associations between
                      nurse-related characteristics, attitudes, and perceived self-
                      efficacy levels toward patient aggression, a forward stepwise
                      linear regression analysis was performed. Associated factors
                      with a significance value of less than or equal to .05 were
                      included in the model. In the second phase, a backward regres-
                      sion analysis was performed to verify the results of forward
                      regression analysis. The backward regression analyses crite-
                      rion to remove the predictor was held at F greater than or equal
                      to .100. The models were checked for multi-collinearity.

                      Results

                      Sample Characteristics

                      A total of 219 nurses participated in this study. The mean age
                      of the participants was 41.23 (SD 11.43) years and 72.6% were
                      female. The sample consisted of 53.9% nurses with a bachelor

                      of science degree. A degree in psychiatric nursing was
                      obtained by 79.4% of the participating nurses. This degree at
                      bachelor and diploma level is obtained by following optional
                      courses within the regular nursing curriculum. Almost 54%
                      of the nurses had 10 or more years of work experience in psy-
                      chiatric care, and 26.5% had worked 10 years or longer on the
                      participating ward. An overview of the general characteristics
                      of the sample is presented in Table 2.

                      Attitude Toward Inpatient Aggression

                      The mean score on the ATABQ was 37.36 (SD 3.79). Group
                      comparisons for the total ATABQ score revealed no

                      Table 1. InternalConsistencyTranslated
                      Questionnaires

                      Questionnaire
                      Dutch version
                      Cronbach’s α

                      French version
                      Cronbach’s α

                      Attitude (ATABQ) .35 .52
                      Self-efficacy (CCPAI) .91 .90
                      Professional quality of life (ProQoL) .56 .52

                      ATABQ, Attitude Toward Aggressive Behavior Questionnaire; CCPAI, Confidence in Coping With
                      PatientAggression Instrument; ProQoL, ProfessionalQuality of LifeQuestionnaire.

                      Table 2. GeneralCharacteristics of Sample

                      Characteristics (n = 219) N (%)

                      Gender
                      Female 159 (72.6)
                      Male 52 (23.7)
                      Missing 8 (3.7)

                      Age (years)
                      21–30 52 (23.7)
                      31–40 51 (23.3)
                      41–50 51 (23.3)
                      >50 63 (28.8)
                      Missing 2 (.9)

                      Workexperience inpsychiatry (years)
                      <1 18 (8.2)
                      1–5 41 (18.7)
                      6–10 42 (19.2)
                      >10 118 (53.9)
                      Missing 0 (.00)

                      Workexperienceonward (years)
                      <1 44 (20.1)
                      1–5 64 (29.2)
                      6–10 52 (23.7)
                      >10 58 (26.5)
                      Missing 1 (.50)

                      Educational degree
                      Diploma levela 96 (43.8)
                      Bachelorof sciencedegree 118 (53.9)
                      Missing 5 (2.3)

                      Degree inpsychiatric nursing
                      Yes 174 (79.4)
                      No 40 (18.3)
                      Missing 5 (2.3)

                      aDiploma level is a3-yearnurse trainingeducationatqualification level 5
                      of theEuropeanHigher EducationArea.

                      16 Perspectives in Psychiatric Care 52 (2016) 12–24
                      © 2014 Wiley Periodicals, Inc.

                      Mental Health Nurses’ Attitudes and Perceived Self-Efficacy Toward Inpatient Aggression

                      significant differences for the nurse-related characteristics
                      under study (see Table 3). It demonstrated only weak correla-
                      tions with compassion satisfaction (r = .143, p < .05) and
                      burnout (r = −.149, p < .05) (see Table 4). None of the nurse-
                      related characteristics were retained in the regression analysis
                      (see Table 5).

                      Associations with nurse-related characteristics were found
                      at subscale level (see Tables 3 and 4). The subscale “predic-
                      tion” revealed a mean score of 3.85 (SD .59). A weak negative
                      correlation was found between this aspect of attitude toward
                      patient aggression and age (r = −.178, p < .05) (see Table 4).
                      The factor age was included in the regression analysis. The
                      model had a predictive value of less than 10% (see Table 5).

                      The subscale “attribution and responsibility” revealed a
                      mean score of 3.31 (SD .48). Group comparisons demon-
                      strated significant differences for gender (see Table 3). Female
                      nurses had statistically significantly higher scores on ques-
                      tions regarding patient attribution and responsibility for
                      aggressive incidents than male nurses (3.35 vs. 3.18,
                      t = −2.203, df = 205, p = .029). Higher scores refer to a lower
                      tendency to place blame and thus a more tolerant perspective
                      on aggression. Negative correlations (see Table 4) were found
                      between attribution and responsibility for aggressive inci-
                      dents on the one hand, and the years of work experience in
                      psychiatric care (r = −.166, p < .05), the years of experience on
                      the ward (r = −.155, p < .05), and level of burnout (r = −.148,
                      p < .05) on the other hand. The mentioned significant or cor-
                      related factors were included in the regression analysis. The
                      model had a predictive value of less than 10% (see Table 5).

                      The subscale “staff anxiety and fear of assault” revealed a
                      mean score of 3.93 (SD .62). Higher scores refer to the belief
                      that aggression is part of working in psychiatric care. Signifi-
                      cant group differences were demonstrated for post-traumatic
                      stress levels (F = 4.569, df = 2, p = .012) (see Table 3). Mental
                      health nurses in the categories low and moderate post-
                      traumatic stress level considered aggression more as a part of
                      the job. This subscale revealed no significant correlations (see
                      Table 4). None of the nurse-related characteristics were
                      retained in the regression analysis (see Table 5).

                      The mean score on the subscale “need skilled intervention”
                      was 4.18 (SD .45). Higher scores referred to a higher belief in
                      the importance and need for training and for skills to prevent
                      and manage aggression. Group comparisons demonstrated
                      significant differences for degree in psychiatric nursing and
                      borderline significance with gender (see Table 3). Nurses who
                      did not have a degree in psychiatric nursing revealed a signifi-
                      cantly higher need for specific training and skills to prevent
                      and manage aggressive behavior compared to nurses with a
                      degree in psychiatric nursing (4.36 vs. 4.14, t = 2.729, df = 211,
                      p = .007). Male nurses reported a higher need for intervention
                      training to prevent and manage aggression than their female
                      colleagues (4.25 vs. 4.14, t = 1.901, df = 208, p = .059). A low
                      positive correlation was found with compassion satisfaction

                      (r = .156, p < .05) (see Table 4). The mentioned significant or
                      correlated factors were included in the regression analysis. The
                      model had a predictive value of less than 10% (see Table 5).

                      The mean score on the subscale “staff confidence” was 3.76
                      (SD .67). Group comparisons within this subscale demon-
                      strated significant difference for gender and compassion sat-
                      isfaction (see Table 3). Male mental health nurses had
                      statistically significantly higher scores on the subscale of con-
                      fidence in the ability to deal with and having control over
                      patients with aggression (4.00 vs. 3.68, t = 3.111, df = 101, p =
                      .001). Mental health nurses with a high or moderate level of
                      compassion satisfaction had a statistically significantly higher
                      score on this subscale (F = 10.878, df = 2, p = .000). It demon-
                      strated a positive correlation with compassion satisfaction
                      (r = .307, p < .01) and a negative correlation with secondary
                      traumatic stress (r = −.192, p < .01) (see Table 4). The men-
                      tioned significant or correlated factors were included in the
                      regression analysis. Staff confidence in dealing with aggres-
                      sion has two predictors: gender and compassion satisfaction.
                      These two factors explained 14.4% of the variance in staff
                      confidence in dealing with aggressive incidents (see Table 5).

                      Perceived Self-Efficacy

                      The mean score on the …

                      Research


                      Objective:

                      1. Explain the role of nursing research within clinical practice.


                      Topic:

                      Overview

                      In this assignment, you will describe a patient problem that you see or have seen in practice. You will then identify, revise, or develop a policy, protocol, algorithm, or standardized guideline to be used in your practice site that is based on current research evidence. You are proposing the implementation of an intervention that is supported by research; thus you are proposing an evidence-based practice (EBP) project. You are not proposing a

                      study to be conducted in your agency.

                      Your final paper should be no more than 5 pages, which does not include the protocol, policy, or algorithm, and references for your project. This assignment is worth 100 points.

                      Ideas for Selection of an Evidence-Based Intervention for Practice

                      Describe a patient problem that is relevant to your practice. It can be any patient care problem orthat is of interest to you in your current practice or for your future role as an administrator. Find an intervention that is considered effective based on research to manage this problem. Important clinical areas that have been researched include the following:

                      · Fall prevention or management

                      · Prevention of pressure ulcers

                      · IV and/or arterial line management

                      · Infection control problems—select a specific situation

                      · Pain identification, documentation, and/or management

                      · Visitation in ICUs

                      · Family involvement intervention based on research

                      · Nurse Retention intervention

                      · Alternative staffing process

                      · Safety—pick a specific situation and implement a research-based intervention to manage it.

                      · Shift of care from hospital to home and/or ambulatory care centers

                      · Nursing leadership—effective leadership behavior that is research based

                      · Communication of shift in specialized way based on research

                      · Provision of specific aspect of care (research-based intervention) to patients with illness such as hypertension, diabetes, congestive heart failure, chronic obstructive lung disease, asthma, obesity, renal problems, gastrointestinal problems, or mental health problems.

                      Include the following in your paper:

                      · Introduction—provide a brief introduction of your paper including a purpose statement at the end of the introduction (one paragraph)

                      · Summarize your project topic—include a summary of the patient problem project you chose and the rationale for choosing it; provide support for choosing your topic from the healthcare literature showing that this is a patient problem (2-3 paragraphs)

                      · Literature review—include relevant scholarly, peer-reviewed articles that discuss your patient problem and the proposed intervention. Summarize what is known and not know about the problem selected. At least 3-5 articles should be included in your literature review. (3-5 paragraphs)

                      · Proposed Change—Discuss your revision/identification/development of a policy/protocol/algorithm/standardized guideline to be used in your practice site; analyze how it will be implemented and potential affected parties. (provide a copy as an appendix to your paper with any relevant references included) If you are revising a current policy/protocol, please include the original, as well. (3-5 paragraphs)

                      · Conclusion—Summarize your paper including your patient problem and proposed change; do not introduce new information here, simply synthesis the information you provided in your paper.

                      This criterion is linked to a Learning OutcomeIntroduction/Conclusion

                      30 pts

                      Level 5

                      Grabs the reader’s attention; provides a complete and concise introduction/conclusion to the paper; a purpose statement relevant to the paper is included.

                      27 pts

                      Level 4

                      Interesting & might get the reader’s attention; provides a complete introduction/conclusion; purpose statement is included, but is vaguely worded.

                      24 pts

                      Level 3

                      Relevant but does not engage the reader’s attention; provides an introduction/conclusion, but it is incomplete, lengthy, or too short; purpose statement is included, but is vaguely worded.

                      21 pts

                      Level 2

                      Relevant but does not engage the reader’s attention; provides an introduction/conclusion, but it is incomplete, lengthy, and/or too short; purpose statement not included

                      18 pts

                      Level 1

                      Dull or trite introduction/conclusion; incomplete or rambling; no purpose statement included.

                      0 pts

                      Level 0

                      No paper was submitted.

                      30 pts

                      This criterion is linked to a Learning OutcomeProject Summary

                      NM465-CO4

                      30 pts

                      Level 5

                      Includes a summary of the patient problem project chosen and the rationale for choosing it; support is provided for chosen topic from the healthcare literature showing that this is a patient problem; the summary is well-developed and provides sufficient detail.

                      27 pts

                      Level 4

                      Includes a summary of the patient problem project chosen and the rationale for choosing it; support is provided for chosen topic from the healthcare literature showing that this is a patient problem; the summary is developed, but lacks depth.

                      24 pts

                      Level 3

                      Includes a summary of the patient problem project chosen; rationale included, but not well-defined; the topic was not supported by literature as a patient problem; the summary is partially developed.

                      21 pts

                      Level 2

                      Includes an incomplete summary of the patient problem project chosen; rationale, if included, was not well-defined or supported by literature.

                      18 pts

                      Level 1

                      The summary did not discuss the patient problem; no rationale included; rambling or incoherent ideas.

                      0 pts

                      Level 0

                      No paper was submitted.

                      30 pts

                      This criterion is linked to a Learning OutcomeLiterature Review

                      NM465-CO4

                      30 pts

                      Level 5

                      3-5 relevant, scholarly, peer-reviewed articles related to patient problem/proposed intervention are synthesized; Summary of what is known/not known about the problem is included.

                      27 pts

                      Level 4

                      3-5 relevant, scholarly, peer-reviewed articles related to patient problem/proposed intervention are included, but findings are not synthesized; Summary of what is known/not known about the problem is included.

                      24 pts

                      Level 3

                      3-5 articles related to patient problem/proposed intervention are included, but they are either not relevant, not scholarly, or not peer-reviewed; Summary of what is known/not known about the problem is included.

                      21 pts

                      Level 2

                      Less than 3 articles included OR articles included are not related to the chosen topic; Summary of what is known/not known about the problem is not included.

                      18 pts

                      Level 1

                      Less than 3 articles included; no summary of what is known/not known about the problem not included; rambling or incoherent ideas.

                      0 pts

                      Level 0

                      No paper was submitted.

                      30 pts

                      This criterion is linked to a Learning OutcomeProposed Change

                      NM465-CO4

                      30 pts

                      Level 5

                      The proposed change is discussed in sufficient detail; analysis of implementation is well-developed; potential affected parties are discussed.

                      27 pts

                      Level 4

                      The proposed change is discussed; analysis of implementation is somewhat developed; potential affected parties are discussed.

                      24 pts

                      Level 3

                      The proposed change is discussed, but lacks details; analysis of implementation is partially developed; potential affected parties are identified.

                      21 pts

                      Level 2

                      The proposed change is not discussed sufficiently; analysis of implementation is poorly developed; potential affected parties are identified.

                      18 pts

                      Level 1

                      The proposed change is not discussed in a coherent manner; analysis of implementation is not included; potential affected parties are not identified.

                      0 pts

                      Level 0

                      No paper was submitted.

                      30 pts

                      This criterion is linked to a Learning OutcomeGrammar/APA

                      PRICE-I

                      30 pts

                      Level 5

                      Mostly free of grammatical and spelling errors. APA format was used correctly. Thoughts flow cohesively throughout the paper.

                      27 pts

                      Level 4

                      Minimal grammatical and spelling errors. APA format was followed with minimal mistakes. Thoughts flow cohesively throughout the paper.

                      24 pts

                      Level 3

                      Moderate amounts of grammatical and spelling errors. APA format was followed but inconsistently; paper does not flow and does not tie the information together.

                      21 pts

                      Level 2

                      Major grammatical and spelling errors. APA was used incorrectly. Paper does not flow and does not tie the information together.

                      18 pts

                      Level 1

                      An unacceptable number of spelling, and grammar. APA format was not followed. Rambling or incoherent ideas throughout the paper.

                      0 pts

                      Level 0

                      No paper was submitted.

                      30 pts

                      Total Points: 150


                      Previous


                      Next

                      RESEARCH

                      A research critique demonstrates your ability to critically read an investigative study. For this assignment, choose a research article related to nursing.

                      · Articles must be qualitative or quantitative research papers.

                      · The selected articles should be original research articles. Review articles, concept analysis, meta-analysis, meta-synthesis, integrative review, and systemic review should not be used.

                      · Mixed-methods studies should not be used.

                      · Dissertations should not be used.

                      Your critique should include the following:

                      Research Problem/Purpose

                      · State the problem clearly as it is presented in the report.

                      · Have the investigators placed the study problem within the context of existing knowledge?

                      · Will the study solve a problem relevant to nursing?

                      · State the purpose of the research.

                      Review of the Literature

                      · Identify the concepts explored in the literature review.

                      · Were the references current? If not, what do you think the reasons are?

                      · Was there evidence of reflexivity in the design (qualitative)? 

                      Theoretical Framework

                      · Are the theoretical concepts defined and related to the research?

                      · Does the research draw solely on nursing theory or does it draw on theory from other disciplines?

                      · Is a theoretical framework stated in this research piece?

                      · If not, suggest one that might be suitable for the study.

                      Variables/Hypotheses/Questions/Assumptions (Quantitative)

                      · What are the independent and dependent variables in this study?

                      · Are the operational definitions of the variables given? If so, are they concrete and measurable?

                      · Is the research question or the hypothesis stated? What is it?

                      Conceptual Underpinnings, Research Questions (Qualitative)

                      · Are key concepts defined conceptually?

                      · Is the philoosoophical basis, underlying tradition, conoceptual framework, or ideological orientation made explicit and is it appropriate for the problem?

                      · Are research questions explicitly stated? Are the questions consistent with the study’s philosophical basis, underlying tradition, conceptual framework, or ideological orientation?

                      Methodology

                      · What type of design (quantitative, qualitative, and type) was used in this study?

                      · Was inductive or deductive reasoning used in this study?

                      · State the sample size and study population, sampling method, and study setting.

                      · Did the investigator choose a probability or non-probability sample?

                      · State the type of reliability and the validity of the measurement tools (quantitative only)

                      Qualitative studies (answer the following questions in addition to those above except the last bulleted item)

                      · Were the methods of gathering data appropriate?

                      · Were data gathered through two or more methods to achieve triangulation?

                      · Did the researcher ask the right questions or make the right observations and were they recorded in an appropriate fashion?

                      · Was a sufficient amount of data gathered?

                      · Was the data of sufficient depth and richness?

                      Were ethical considerations addressed? Were appropriate procedures used to safeguard the rights of study participants?

                      Data Analysis

                      · What data analysis tool was used?

                      · Was saturation achieved? (qualitative)

                      · How were the results presented in the study?

                      · Were the data management (e.g., coding) and data analysis methods sufficiently described? (qualitative)

                      · Identify at least one (1) finding.

                      Summary/Conclusions, Implications, and Recommendations

                      · Do the themes adequately capture the meaning of the data?

                      · Did the analysis yield an insightful, provocative and meaningful picture of the phenomenon under investigation?

                      · Were methods used to enhance the trustworthiness of the data (and analysis) and was the description of those methods adequate?

                      · Are there clear explanation of the boundaries/limitations, thick description, audit trail?

                      · What are the strengths and limitations of the study?

                      · In terms of the findings, can the researcher generalize to other populations? Explain.

                      · Evaluate the findings and conclusions as to their significance for nursing (both qualitative and quantitative).

                      The body of your paper should be 4–6 double-spaced pages plus a cover page and a reference page. The critique must be attached to the article and follow APA guidelines.

                      Research

                      using this PICOT question  in adolescents aged 12-14 years (P), do introduce substance abuse programs (I) compared to no substance abuse programs (C) reduce substance abuse (O) within one year (T). by restating this PICOT above .

                          Develop a problem statement/research question for a research study that might be of interest to you.. Select a quantitative research design you think would be best to address this question. Discuss the rationale for your design selection and why it is a good fit. I need this done APA format 7th edition. Two pages.